View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18559_high_15 (Length: 381)
Name: NF18559_high_15
Description: NF18559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18559_high_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 3e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 230 - 366
Target Start/End: Complemental strand, 42635287 - 42635151
Alignment:
| Q |
230 |
aaaattcttaccttggcacaaccacctcaatgagtgtggacctttcagccggcaatcgtctgatctccagtgatttcggaacacttgttgtaaccctttc |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42635287 |
aaaattcttaccttggcacaaccacctcaatgagtgtggacctttcggccggcaatcgtctgatctctagtgatttcggaacacttgttgtaaccctttc |
42635188 |
T |
|
| Q |
330 |
tgtaaaagtcatctcctcatattgagtggccattaat |
366 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42635187 |
tgtaaaagtcatctcctcatattaagtggccattaat |
42635151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 23 - 95
Target Start/End: Complemental strand, 42636375 - 42636304
Alignment:
| Q |
23 |
tccgaaataagtagtgaaaacactactaaatgaagcacaaatagaaccttgaattcactaaaatagataatgg |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42636375 |
tccgaaataagtagtgaaaacactactaaatgaagcacaaatagaacc-tgaattcactaaaatagataatgg |
42636304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University