View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18559_high_17 (Length: 291)
Name: NF18559_high_17
Description: NF18559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18559_high_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 28 - 286
Target Start/End: Complemental strand, 2161987 - 2161736
Alignment:
| Q |
28 |
gggttttcatagtgcattgggaagtgatctattcggaagagattagattctcgcatggaatccagaaattgatagcagttatttgcatcttattgctagg |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
2161987 |
gggttttcatagtgcattgggaagtgatctattcggaagagattagattctcgcatggaatccagaaattgataacagctatttgcatcttattgctagg |
2161888 |
T |
|
| Q |
128 |
ttacgctgttagaagcatagtgcttgatttcaagtcataattttgccttctagcttgatagggtatctagaattacatctagcttggtagggtatctagc |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2161887 |
ttacgctgttagaagcatagtgcttgatttcaagtcataa-------ttctagcttgatagggtatctagaattacatctagcttggtagggtatctagc |
2161795 |
T |
|
| Q |
228 |
ttttgaaatttagaatctagttagtatttcttttattttttacacggcaaatattattc |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |||| |||||| |
|
|
| T |
2161794 |
ttttgaaatttagaatctagttagtatttcttctattttttacacgggaaatgttattc |
2161736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 84 - 148
Target Start/End: Complemental strand, 2179630 - 2179566
Alignment:
| Q |
84 |
ggaatccagaaattgatagcagttatttgcatcttattgctaggttacgctgttagaagcatagt |
148 |
Q |
| |
|
|||||||||| |||||||||||||| ||| || ||||||||| ||| ||||||| | ||||||| |
|
|
| T |
2179630 |
ggaatccagatattgatagcagttacttggttcctattgctagcttatgctgttaaaggcatagt |
2179566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University