View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18559_low_24 (Length: 248)
Name: NF18559_low_24
Description: NF18559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18559_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 230
Target Start/End: Original strand, 35922369 - 35922581
Alignment:
| Q |
18 |
agatgaatagatcaataacatcaaataattagttaaaatgcatcatatatcacatgacaaataacaatttatcagaaattctgcattttgtggagacaaa |
117 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35922369 |
agatgaatagaccaataacatcaaataattagttaaaatgcatcatatatcacatgacaaataacaatttatcagaaattctgcattttgtggagacaaa |
35922468 |
T |
|
| Q |
118 |
gaaagtgatagtaggaattcatttttcttttgagggctcgaggataatacttccnnnnnnnntgttctgttttggaatttagatgccacataccaaccca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35922469 |
gaaagtgatagtaggaattcatttttcttttgagggctcgaggataatacttccaaaaaaaatgttctgttttggaatttagatgccacataccaaccca |
35922568 |
T |
|
| Q |
218 |
cactcttcagttc |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35922569 |
cactcttcagttc |
35922581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University