View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18559_low_25 (Length: 246)
Name: NF18559_low_25
Description: NF18559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18559_low_25 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 3046399 - 3046186
Alignment:
| Q |
1 |
agggtgtttgttagtgaaggtggattttgagaaaggatatcattccgttagttagatgttcttggaatatatgatgggaagaatgaatctcgatttggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3046399 |
agggtgtttgttagtgaaggtggattttgagaaaggatatgattccgttagtt----------ggaatatatgatgggaagaatgaatctcgatttggtt |
3046310 |
T |
|
| Q |
101 |
ggatgaaggaagtcttccatatttggaagctcaatgattgtagttaatttatggaagcggagaaagacgtgtgtctttccactaggtatgattgatgtaa |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
3046309 |
ggatgaaggaagacttccatatttggaagctcaatgattgtagttaatttatggaagcgaagaaagacgtgcgtctttccactagttatgattgatgtaa |
3046210 |
T |
|
| Q |
201 |
tgtcttctatgtaatggggttgga |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
3046209 |
tgtcttctatgtaatggggttgga |
3046186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University