View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18559_low_28 (Length: 216)
Name: NF18559_low_28
Description: NF18559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18559_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 19 - 200
Target Start/End: Complemental strand, 2920645 - 2920464
Alignment:
| Q |
19 |
gatcataaggcctaaagagcaaagggtgttcctcatccacaagctcctccggagcttttataatgtaccctcctttcgggatagagaacaacccggttga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2920645 |
gatcataaggcctaaagagcaaagggtgttcctcatccacaagctcctccggagcttttataatgtaccctcctttcgggatagagaacagcccggttga |
2920546 |
T |
|
| Q |
119 |
atatcgtgcctcattcccattcatcatcacccgatgaaacggcgaatgcagcctcccgtttgaccatgcctgcaaaattcat |
200 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2920545 |
atatcgtgcctcgttcccactcatcatcacccgatgaaacggcgaatgcagcctcccgtttgaccatgcctgcaaaattcat |
2920464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 19 - 197
Target Start/End: Complemental strand, 2935493 - 2935315
Alignment:
| Q |
19 |
gatcataaggcctaaagagcaaagggtgttcctcatccacaagctcctccggagcttttataatgtaccctcctttcgggatagagaacaacccggttga |
118 |
Q |
| |
|
||||| ||||| |||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||| ||| ||||||||||||| | ||| |
|
|
| T |
2935493 |
gatcaaaaggcttaaagagcaaagggtgctcctcgtccaccagctcctccggagcttttataatgtaccctcctttgggggtagagaacaaccctgctga |
2935394 |
T |
|
| Q |
119 |
atatcgtgcctcattcccattcatcatcacccgatgaaacggcgaatgcagcctcccgtttgaccatgcctgcaaaatt |
197 |
Q |
| |
|
||||| ||||||||||||| |||||||||||| ||||| |||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
2935393 |
atatcttgcctcattcccactcatcatcaccctgtgaaatggcgaatgcaacctcccgtttgaccatgcctacaaaatt |
2935315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University