View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1855_high_9 (Length: 321)
Name: NF1855_high_9
Description: NF1855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1855_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 138 - 269
Target Start/End: Original strand, 35420987 - 35421118
Alignment:
| Q |
138 |
gtgttgttggatcttctgtgtttctgttagcaactattgttgttgtttttgaggctgaacaacccatgtttaagttaagaaaattgggttgtgtttactt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35420987 |
gtgttgttggatcttctgtgtttctgttagcaactattgttgttgtttttgaggctgaacaacccatgtttaagttaagaaaattgggttgtgtttactt |
35421086 |
T |
|
| Q |
238 |
ttgcaacctctctctagaatagaaaagatacc |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35421087 |
ttgcaacctctctctagaatagaaaagatacc |
35421118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 35420850 - 35420912
Alignment:
| Q |
1 |
ttttttggttggagggtgatggataagaggcattgtaagggacaaagcttttctaactggtgg |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35420850 |
ttttttggttggagggtgatggataagaggcattgtaagggacaaagcttttctaactggtgg |
35420912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University