View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18562_high_13 (Length: 253)
Name: NF18562_high_13
Description: NF18562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18562_high_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 1e-83; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 8976315 - 8976062
Alignment:
| Q |
1 |
ttatgtcatcaaagtaatatcaataaatatcattaattatatttaaagtctctaacatcaattgtgtccnnnnnnnnnnnnnn----tttgaaggaattg |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8976315 |
ttatgtcatcaaagtaatatcaataaatatcattaattatatttaaagtctctaacatcaattgtgtccatatatatatatatatattttgaaggaattg |
8976216 |
T |
 |
| Q |
97 |
tgtccatatatatgtgtgctcatttcctctcaattgcattcatcccaacatttg-------aaaattggtaatattgtgcaaggatgacaatgaagttag |
189 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8976215 |
tgtccatatatatgtgtgctcatttactctcaattacattcatcccaacatttttcatttcaaaattggtaatattgtgcaaggatgacaatgaagttag |
8976116 |
T |
 |
| Q |
190 |
gaagcattctcttaatggttggagctttgtttgctctcttcaccctcacctatg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8976115 |
gaagcattctcttaatggttggagctttgtttgctctcttcaccctcacctatg |
8976062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 153 - 241
Target Start/End: Original strand, 8940668 - 8940756
Alignment:
| Q |
153 |
aattggtaatattgtgcaaggatgacaatgaagttaggaagcattctcttaatggttggagctttgtttgctctcttcaccctcaccta |
241 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| ||||| | || |||||||||||||||||| |
|
|
| T |
8940668 |
aattggtaatattgtgcaaggatgataatgaagttgggaagcattctcttaatggttggggctttatctgttctcttcaccctcaccta |
8940756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 168 - 243
Target Start/End: Complemental strand, 8992295 - 8992220
Alignment:
| Q |
168 |
gcaaggatgacaatgaagttaggaagcattctcttaatggttggagctttgtttgctctcttcaccctcacctatg |
243 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||| |||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
8992295 |
gcaagtatgacaatgaagtaaggaagcattctcttaacggttggggctttgtttgctctcttcacactcacctatg |
8992220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 168 - 243
Target Start/End: Complemental strand, 9016742 - 9016667
Alignment:
| Q |
168 |
gcaaggatgacaatgaagttaggaagcattctcttaatggttggagctttgtttgctctcttcaccctcacctatg |
243 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||| |||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
9016742 |
gcaagtatgacaatgaagtaaggaagcattctcttaacggttggggctttgtttgctctcttcacactcacctatg |
9016667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 210 - 243
Target Start/End: Original strand, 14869667 - 14869700
Alignment:
| Q |
210 |
ggagctttgtttgctctcttcaccctcacctatg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
14869667 |
ggagctttgtttgctctcttcaccctcacctatg |
14869700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University