View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18562_high_15 (Length: 238)
Name: NF18562_high_15
Description: NF18562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18562_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 77 - 222
Target Start/End: Original strand, 40241880 - 40242025
Alignment:
| Q |
77 |
ttttcttatctcaaatataatgtatactatactttnnnnnnnnn-tcgttataattttaattgatctgatttccttttgtaaataaaagcccctaagcct |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40241880 |
ttttcttatctcaaatataatgtatactatacttaaaaaaaaaaatcgttataattt-aattgatctgatttctttttgtaaataaaagcccctaagcct |
40241978 |
T |
 |
| Q |
176 |
taaaaagagaaattacaaagaaaatatttgcctaaaatcatgaacaa |
222 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40241979 |
aaaaaagagaagttacaaagaaaatatttgcctaaaatcatgaacaa |
40242025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University