View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18562_high_16 (Length: 236)
Name: NF18562_high_16
Description: NF18562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18562_high_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 26226204 - 26226407
Alignment:
| Q |
1 |
ttgacctagttttatgcaatagtaatgcaaaggagtgagtgatacttataatgagagaagtgatnnnnnnntgttttagacattcaataatttaaagatt |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26226204 |
ttgacctagtgttatgcaatagtaatgcaaaggagtgagtgatacttataatgagagaagtgatacaaaaatgttttagacattcaataatttaaagatt |
26226303 |
T |
|
| Q |
101 |
attcctaagaaagcataagatatagtatttgtcagccttaaaatgaaaatcacaannnnnnnncaaaacaattactaatcaaaaggatttttatgagaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26226304 |
attcctaagaaagcataagatatagtatttgtcagccttaaaatgaaaatcacaa-ttttcttcaaaacaattattaatcaaaaggatttttatgagaag |
26226402 |
T |
|
| Q |
201 |
ctata |
205 |
Q |
| |
|
||||| |
|
|
| T |
26226403 |
ctata |
26226407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University