View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18562_high_20 (Length: 210)
Name: NF18562_high_20
Description: NF18562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18562_high_20 |
 |  |
|
| [»] scaffold0530 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0530 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: scaffold0530
Description:
Target: scaffold0530; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 23 - 193
Target Start/End: Complemental strand, 5798 - 5628
Alignment:
| Q |
23 |
agtgttccaattataatttgtttattatcagaatggcaaagaggaaggaagtactggtaaagaagatgcaacatgtgtaggtgatttgttgagtgtagat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5798 |
agtgttccaattataatttgtttattatcagaatggcaaagaggaaggaagtactggtaaagaagatggaacatgtgtaggtgatttgttgagtgtagat |
5699 |
T |
 |
| Q |
123 |
gagtcagatccttctccagacaagaatgaggctactgtaccgacacaagcagccgatcttatggtaagtat |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5698 |
gagtcagatccttctccagacaagaatgaggctactgtaccgacacaagcagccgatcttatggtaagtat |
5628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University