View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18562_low_12 (Length: 269)
Name: NF18562_low_12
Description: NF18562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18562_low_12 |
 |  |
|
| [»] scaffold0856 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0856 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: scaffold0856
Description:
Target: scaffold0856; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 31 - 251
Target Start/End: Complemental strand, 3497 - 3277
Alignment:
| Q |
31 |
agcaaatagcatttatatgattaatccagccttcagttttttctatcttgtagaatatattactcctttagttgcccttgaaatgggaagtccgttagtg |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3497 |
agcaaatagcatttatatgattaatccagccttcagttttttctatcttgtagaatatattactcctttagttgcccttgaaatgggaagtccgttagtg |
3398 |
T |
 |
| Q |
131 |
agtggacttaggaacctcttcattgagtatattatcatatttgaaattgaaagatcccttcttatgaaacaaagtgaaatggagtaagatggtcccagaa |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3397 |
agtggacttaggaacctcttcattgagtatattatcatatttgaaattgaaagatcccttcttatgaaacaaagtgcaatggagtaagatggtcccagaa |
3298 |
T |
 |
| Q |
231 |
tcaagttagctgagtcactac |
251 |
Q |
| |
|
| ||||||||||||||||||| |
|
|
| T |
3297 |
taaagttagctgagtcactac |
3277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University