View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18562_low_22 (Length: 210)

Name: NF18562_low_22
Description: NF18562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18562_low_22
NF18562_low_22
[»] scaffold0530 (1 HSPs)
scaffold0530 (23-193)||(5628-5798)


Alignment Details
Target: scaffold0530 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: scaffold0530
Description:

Target: scaffold0530; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 23 - 193
Target Start/End: Complemental strand, 5798 - 5628
Alignment:
23 agtgttccaattataatttgtttattatcagaatggcaaagaggaaggaagtactggtaaagaagatgcaacatgtgtaggtgatttgttgagtgtagat 122  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
5798 agtgttccaattataatttgtttattatcagaatggcaaagaggaaggaagtactggtaaagaagatggaacatgtgtaggtgatttgttgagtgtagat 5699  T
123 gagtcagatccttctccagacaagaatgaggctactgtaccgacacaagcagccgatcttatggtaagtat 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5698 gagtcagatccttctccagacaagaatgaggctactgtaccgacacaagcagccgatcttatggtaagtat 5628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University