View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18562_low_23 (Length: 205)
Name: NF18562_low_23
Description: NF18562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18562_low_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 30 - 191
Target Start/End: Complemental strand, 29058593 - 29058432
Alignment:
| Q |
30 |
aatcaaaggactttgttgttaaaatagctcatgcaggtggaaaacaagatgtttataggcacgcggttcctgtttacacgttgatgacaaagtatccagg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29058593 |
aatcaaaggactttgttgttaaaatagctcatgcaggtggaaaacaagatgtttatagacacgcggttcctgtttacgcgttgatgacaaagtatccagg |
29058494 |
T |
|
| Q |
130 |
tatgtgtattgcaagtccagaagttttcaaatctcctccccaatctgtattatggaaagaag |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29058493 |
tatgtgtattgcaagtccagaagttttcaaatctcctcaccaatctgtattatggaaagaag |
29058432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University