View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18563_high_24 (Length: 256)

Name: NF18563_high_24
Description: NF18563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18563_high_24
NF18563_high_24
[»] chr8 (1 HSPs)
chr8 (17-152)||(16963306-16963443)


Alignment Details
Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 17 - 152
Target Start/End: Complemental strand, 16963443 - 16963306
Alignment:
17 atgacacttttggcatcacgtatgccactttttagttactaaacaaaaa-cttttatgtgtgtgtcagcctgtcaggttagcattccacaatta-tttat 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||    
16963443 atgacacttttggcatcacgtatgccactttttagttactaaacaaaaaacttttatgtgtgtgtcagcctgtcaggttagcattccacaattattttat 16963344  T
115 taaaatagttaacacaacgtgaattcagaatctcaagt 152  Q
    ||||||||||||||||||||||||||||||||||||||    
16963343 taaaatagttaacacaacgtgaattcagaatctcaagt 16963306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University