View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18563_high_26 (Length: 249)
Name: NF18563_high_26
Description: NF18563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18563_high_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 6 - 240
Target Start/End: Complemental strand, 10844465 - 10844232
Alignment:
| Q |
6 |
acaaggcttgtaaattaagagggagaaaggcagaggcgggtttcaggaccaaaccaagatccagagtgcctttgaacttaagagtaaccggagattcata |
105 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
10844465 |
acaaggcttgtaaattaagagggagataggcagaggcagatttcaggaccaaaccaagatccagagtgcctttgaact--agagtaaccagagattcata |
10844368 |
T |
 |
| Q |
106 |
ctctagttactcagatttgctagaaactagagtaaccagg-attcatactcaatcggaaggccatcaagaataacatctagttgttctcgaattgagact |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10844367 |
ctctagttactcagatttgctagaaactagagtaaccagggattcatactcaatcggaaggccatcaagaataacatctagttgttctcgaattgagact |
10844268 |
T |
 |
| Q |
205 |
atttctccaatagacagaagagaatatgtgtctgtg |
240 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10844267 |
atttctccaatagacataagagaatatgtgtctgtg |
10844232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University