View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18563_high_28 (Length: 242)

Name: NF18563_high_28
Description: NF18563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18563_high_28
NF18563_high_28
[»] chr5 (2 HSPs)
chr5 (22-93)||(26671532-26671603)
chr5 (22-93)||(26943129-26943200)


Alignment Details
Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 22 - 93
Target Start/End: Complemental strand, 26671603 - 26671532
Alignment:
22 ttacacactcaaacatactaggaggtttttatgttttttacgcaacatatactaggaggttatattggaatt 93  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26671603 ttacacactcaaacattctaggaggtttttatgttttttacgcaacatatactaggaggttatattggaatt 26671532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 22 - 93
Target Start/End: Complemental strand, 26943200 - 26943129
Alignment:
22 ttacacactcaaacatactaggaggtttttatgttttttacgcaacatatactaggaggttatattggaatt 93  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26943200 ttacacactcaaacattctaggaggtttttatgttttttacgcaacatatactaggaggttatattggaatt 26943129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University