View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18563_high_32 (Length: 236)
Name: NF18563_high_32
Description: NF18563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18563_high_32 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 16 - 236
Target Start/End: Complemental strand, 34564292 - 34564072
Alignment:
| Q |
16 |
taatctacccctcttatggaaggtggaggtgttatataagatgtacttggaagggatgcaacttgagatgtttcatgtgatgaagtagtagcagatgttc |
115 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34564292 |
taatctacacctctaatggaaggtggaggtgttacataagatgtacttggaagggatgcaacttgagatgtttcatgtgatgaagtagtagcagatgttc |
34564193 |
T |
|
| Q |
116 |
taggttaggtgagacaagacttttgatcatgtgtactagtcacaaaataagtcactgaatcggttgtttgaaccaaatcgatgtctagatttcgtctctg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || ||||| |||||||||| |||| | |||||||||||| |
|
|
| T |
34564192 |
taggttaggtgagacaagacttttgatcgtgtgtactagtcacaaaataagtcactgaattggctgtttcaaccaaatcggtgtccacatttcgtctctg |
34564093 |
T |
|
| Q |
216 |
aatcagtctcccaaaacgtct |
236 |
Q |
| |
|
||||||||||||||| ||||| |
|
|
| T |
34564092 |
aatcagtctcccaaagcgtct |
34564072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University