View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18563_low_20 (Length: 296)
Name: NF18563_low_20
Description: NF18563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18563_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 16 - 288
Target Start/End: Complemental strand, 26422312 - 26422043
Alignment:
| Q |
16 |
tcacttttgtactccagattttagttccacttgcagtttcctttgagttcttttttatccctaaaatattaatctttccctgaatgtgcatcaccacatg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26422312 |
tcacttttgtactccagattttagttccacttgcagtttcctttgagttcttttttatccctaaaatattaatctgtccctgaatgtgcatcaccacatg |
26422213 |
T |
 |
| Q |
116 |
cctgaacttcagctattttctccggctggagtcttaaagtttggaagcatcttctcatatagtctcttctatgaattgtctttcttaatgaataactaac |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26422212 |
cctgaacttcagctattttctccggctggagtcttaaagtttggaagcatcttctcatatagtctcttctatgaattgtctttctcaatgaataactaac |
26422113 |
T |
 |
| Q |
216 |
ttaggtgttttctccccctgttccacgatatttccagtaatcaattcttttaatgtcattccacacctatgct |
288 |
Q |
| |
|
||| |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
26422112 |
tta---gttttctccccctgttccacaatatttccagtaatcaattcttttaatgttattccacacctgtgct |
26422043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University