View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18563_low_25 (Length: 271)
Name: NF18563_low_25
Description: NF18563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18563_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 54 - 253
Target Start/End: Complemental strand, 29593018 - 29592819
Alignment:
| Q |
54 |
aagtcatgcatgttttgagacttcaaggaccaataccggaaaacgatcaatcttaaatgactgctggtaaaattttggcctatcaaaggaaaaggtgact |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29593018 |
aagtcatgcatgttttgagacttcaaggaccaataccggaaaacgatcaatcttaaatgactgctggtaaaattttggcctatcaaaggaaaaggtgact |
29592919 |
T |
 |
| Q |
154 |
tacttggatctgaagtagagatagtagccatgtcattgaagttacatgattcagtagactttctcatcttatgataataagcatcaaaagcataattagc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29592918 |
tacttggatctgaagtagagatagtagccatgtcattgaagttacatgattcagtagactttcccatcttatgataataagcatcaaaagcataattagc |
29592819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University