View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18563_low_27 (Length: 257)
Name: NF18563_low_27
Description: NF18563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18563_low_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 79; Significance: 5e-37; HSPs: 7)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 16 - 118
Target Start/End: Complemental strand, 30943862 - 30943760
Alignment:
| Q |
16 |
atagttaaagagagaaacataataggaaattagattatagatgtatcacctagaatgattttcattttccctttccagctcaactgcttacctgcgatag |
115 |
Q |
| |
|
||||| |||| |||||| | ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30943862 |
atagtaaaagggagaaatacaatagaaaattagattatagatgtatcacctagaatgattttcattttccctttccagctcagctgcttacctgcgatag |
30943763 |
T |
 |
| Q |
116 |
ttg |
118 |
Q |
| |
|
||| |
|
|
| T |
30943762 |
ttg |
30943760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 42 - 116
Target Start/End: Complemental strand, 30954279 - 30954205
Alignment:
| Q |
42 |
aaattagattatagatgtatcacctagaatgattttcattttccctttccagctcaactgcttacctgcgatagt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |||||| |||||||||| |
|
|
| T |
30954279 |
aaattagattatagatgtatcacctagaatgattttcattttcccttgccaactcaaatgcttatctgcgatagt |
30954205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 25 - 109
Target Start/End: Complemental strand, 31223063 - 31222979
Alignment:
| Q |
25 |
gagagaaacataataggaaattagattatagatgtatcacctagaatgattttcattttccctttccagctcaactgcttacctg |
109 |
Q |
| |
|
|||||||| | ||||| || ||| || ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
31223063 |
gagagaaataaaatagaaatttatatcatagatgtatcacctagaatgattttcattttcccttgcctgctcaactgcttacctg |
31222979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 42 - 118
Target Start/End: Complemental strand, 30959938 - 30959862
Alignment:
| Q |
42 |
aaattagattatagatgtatcacctagaatgattttcattttccctttccagctcaactgcttacctgcgatagttg |
118 |
Q |
| |
|
|||||||| | ||| ||||| |||||||||||||||||||||||||| ||| |||| ||||||||||||||||||| |
|
|
| T |
30959938 |
aaattagactgtagttgtattacctagaatgattttcattttcccttgccaactcatttgcttacctgcgatagttg |
30959862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 188 - 228
Target Start/End: Complemental strand, 30943686 - 30943646
Alignment:
| Q |
188 |
ctaataggtaagctgcatatgattggctaaagaagttggga |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30943686 |
ctaataggtaagctgcatatgattggctaaagaagttggga |
30943646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 73 - 116
Target Start/End: Complemental strand, 31213467 - 31213424
Alignment:
| Q |
73 |
attttcattttccctttccagctcaactgcttacctgcgatagt |
116 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
31213467 |
attttcattttcccttgccagctcaactccttacctgcgatagt |
31213424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 63 - 116
Target Start/End: Complemental strand, 31229090 - 31229037
Alignment:
| Q |
63 |
acctagaatgattttcattttccctttccagctcaactgcttacctgcgatagt |
116 |
Q |
| |
|
|||| ||||||||||| ||||| ||| ||||||||| |||||||||| |||||| |
|
|
| T |
31229090 |
accttgaatgattttccttttctcttgccagctcaaatgcttacctgtgatagt |
31229037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University