View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18563_low_28 (Length: 257)

Name: NF18563_low_28
Description: NF18563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18563_low_28
NF18563_low_28
[»] chr6 (1 HSPs)
chr6 (20-238)||(31899444-31899663)
[»] chr3 (5 HSPs)
chr3 (26-238)||(885938-886161)
chr3 (130-238)||(31660104-31660213)
chr3 (130-238)||(31936173-31936282)
chr3 (130-238)||(31974498-31974607)
chr3 (149-232)||(31876269-31876349)


Alignment Details
Target: chr6 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 20 - 238
Target Start/End: Original strand, 31899444 - 31899663
Alignment:
20 cttgtctcttctactgttcttccgattaaagaaagggtacctgggtaggccatcaatgccacttatatttcttcctcaactt----ttattccaaaactt 115  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||    |||||    
31899444 cttgtttcttctactgttcttccgattaaagaaagggtacctgggtaggccatcaatgccacttatatttcttcctcaacttatatttatttatcaactt 31899543  T
116 atatttcttccttggatgcatgcattgcagggattacacggtgtccttcaaaattggcaacagtcccgtacagtcttttaaccttgatattgacacgggt 215  Q
    ||   ||||  |  |||||||||||||||||||||||||||||||||||||||||||||||| ||  |||||||||||||||||||||||||||||||||    
31899544 at---tcttattatgatgcatgcattgcagggattacacggtgtccttcaaaattggcaacaatcatgtacagtcttttaaccttgatattgacacgggt 31899640  T
216 agtgatttcacttgggttcagtg 238  Q
    |||||| ||||||||||||||||    
31899641 agtgatctcacttgggttcagtg 31899663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 5)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 26 - 238
Target Start/End: Original strand, 885938 - 886161
Alignment:
26 tcttctactgttcttccgattaaagaaagggtacctgggtaggccatcaatgccacttatatttcttcctcaacttttattccaaaacttatat------ 119  Q
    |||||||||||||||||| |||||||||||  || |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||          
885938 tcttctactgttcttccgcttaaagaaaggtcacttgggtatgccatcaatgccacttatatttcttcctcaacttttattccaaaacttatatatatca 886037  T
120 -----ttcttccttggatgcatgcattgcagggattacacggtgtccttcaaaattggcaacagtcccgtacagtcttttaaccttgatattgacacggg 214  Q
         |||||  |  |||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |||||||||||||||||||||||    
886038 acttattcttattatgatgcatgcattgcagggattacacggtgtccttcaaatttggcaacaatcccgtacagtcctttaaccttgatattgacacggg 886137  T
215 tagtgatttcacttgggttcagtg 238  Q
    ||||||  ||||||||||||||||    
886138 tagtgaactcacttgggttcagtg 886161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 130 - 238
Target Start/End: Original strand, 31660104 - 31660213
Alignment:
130 gatgcatgcattgcagggattacacggtgtccttcaaaattggcaa-cagtcccgtacagtcttttaaccttgatattgacacgggtagtgatttcactt 228  Q
    ||||||||||||||||||||||||| |||||| |||||||||||   || | |||||||| | |||||||||  |||||||||||||| |||||||||||    
31660104 gatgcatgcattgcagggattacacagtgtccctcaaaattggctggcaattccgtacagccctttaacctttttattgacacgggtactgatttcactt 31660203  T
229 gggttcagtg 238  Q
    ||||||||||    
31660204 gggttcagtg 31660213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 130 - 238
Target Start/End: Complemental strand, 31936282 - 31936173
Alignment:
130 gatgcatgcattgcagggattacacggtgtccttcaaaattggcaa-cagtcccgtacagtcttttaaccttgatattgacacgggtagtgatttcactt 228  Q
    ||||||||||||||||||||||||| |||||| |||||||||||   || | |||||||| | |||||||||  |||||||||||||| |||||||||||    
31936282 gatgcatgcattgcagggattacacagtgtccctcaaaattggctggcaattccgtacagccctttaacctttttattgacacgggtactgatttcactt 31936183  T
229 gggttcagtg 238  Q
    ||||||||||    
31936182 gggttcagtg 31936173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 130 - 238
Target Start/End: Complemental strand, 31974607 - 31974498
Alignment:
130 gatgcatgcattgcagggattacacggtgtccttcaaaattggcaa-cagtcccgtacagtcttttaaccttgatattgacacgggtagtgatttcactt 228  Q
    ||||||||| ||||||||||||||| |||||| ||||||||| |   || | |||||||| | |||||||||  |||||||||||||| |||| ||||||    
31974607 gatgcatgctttgcagggattacacagtgtccctcaaaattgactggcaattccgtacagccctttaacctttttattgacacgggtactgatctcactt 31974508  T
229 gggttcagtg 238  Q
    | ||||||||    
31974507 gtgttcagtg 31974498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 232
Target Start/End: Complemental strand, 31876349 - 31876269
Alignment:
149 ttacacggtgtccttcaaaattggcaacagtcccgtacagtcttttaaccttgatattgacacgggtagtgatttcacttgggt 232  Q
    ||||||||||||| ||||||||||| |   ||||| |||||||||  || ||  ||||||||||||||||||| ||||||||||    
31876349 ttacacggtgtccctcaaaattggcta---tcccggacagtctttcgacgtttttattgacacgggtagtgatctcacttgggt 31876269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University