View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18563_low_29 (Length: 256)
Name: NF18563_low_29
Description: NF18563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18563_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 17 - 152
Target Start/End: Complemental strand, 16963443 - 16963306
Alignment:
| Q |
17 |
atgacacttttggcatcacgtatgccactttttagttactaaacaaaaa-cttttatgtgtgtgtcagcctgtcaggttagcattccacaatta-tttat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16963443 |
atgacacttttggcatcacgtatgccactttttagttactaaacaaaaaacttttatgtgtgtgtcagcctgtcaggttagcattccacaattattttat |
16963344 |
T |
 |
| Q |
115 |
taaaatagttaacacaacgtgaattcagaatctcaagt |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16963343 |
taaaatagttaacacaacgtgaattcagaatctcaagt |
16963306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University