View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18563_low_30 (Length: 253)
Name: NF18563_low_30
Description: NF18563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18563_low_30 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 88 - 253
Target Start/End: Original strand, 29226753 - 29226922
Alignment:
| Q |
88 |
tatttaaatgcaacaatctg----tagcagaaaataactagctgtaatagactttctagtgatgcagaaaatgctaaaactagaatccaagtgctacatc |
183 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29226753 |
tatttaaatgcaacaatctggtcgtaggagaaaataactaactgtaatagactttctagtgatgcagaaaatgctaaaactagaatccaagtgctacatc |
29226852 |
T |
|
| Q |
184 |
atttatgattgtaccggatttttagacactttaacactagctaataatgtatttaaaattaggaaaatgt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29226853 |
atttatgattgtaccggatttttagacactttaacactagctaataatgtatttaaaattaggaaaatgt |
29226922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 59 - 89
Target Start/End: Original strand, 29226156 - 29226186
Alignment:
| Q |
59 |
ctaacccattatatcagttatgctaaaacta |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29226156 |
ctaacccattatatcagttatgctaaaacta |
29226186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University