View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18563_low_34 (Length: 242)
Name: NF18563_low_34
Description: NF18563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18563_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 22 - 93
Target Start/End: Complemental strand, 26671603 - 26671532
Alignment:
| Q |
22 |
ttacacactcaaacatactaggaggtttttatgttttttacgcaacatatactaggaggttatattggaatt |
93 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26671603 |
ttacacactcaaacattctaggaggtttttatgttttttacgcaacatatactaggaggttatattggaatt |
26671532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 22 - 93
Target Start/End: Complemental strand, 26943200 - 26943129
Alignment:
| Q |
22 |
ttacacactcaaacatactaggaggtttttatgttttttacgcaacatatactaggaggttatattggaatt |
93 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26943200 |
ttacacactcaaacattctaggaggtttttatgttttttacgcaacatatactaggaggttatattggaatt |
26943129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University