View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18563_low_35 (Length: 240)
Name: NF18563_low_35
Description: NF18563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18563_low_35 |
 | |
|
| [»] scaffold1519 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold1519 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: scaffold1519
Description:
Target: scaffold1519; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 102 - 219
Target Start/End: Complemental strand, 482 - 365
Alignment:
| Q |
102 |
tattgttgccttaagtcataatcctgtccttcattcaaggacaaaacataggtaactgaacattttctttgtgggagaaaaggttcttagcaagtcctta |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
482 |
tattgttgccttaagtcataatcctgtccttcattcatggacaaaacataggtaactgaacattttctttgtgggagaaagggttcttagcaagtcctta |
383 |
T |
|
| Q |
202 |
attgtttcctatgtccct |
219 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
382 |
attgtttcctatgtccct |
365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1519; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 1390 - 1286
Alignment:
| Q |
1 |
ccatgtctacatactacctctgaagtcttacgggtgtggtcccttcttcaggaacttcaggttctgattaccattcttgtggtttattgtgacagtcatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
1390 |
ccatgtctacatactacctctgaagtcttacgggtgcggtcccttcttcaggaacttcaggttctgattaccagtcctgtggtttattgtgacagtcatg |
1291 |
T |
|
| Q |
101 |
gtatt |
105 |
Q |
| |
|
||||| |
|
|
| T |
1290 |
gtatt |
1286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University