View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18563_low_39 (Length: 236)
Name: NF18563_low_39
Description: NF18563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18563_low_39 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 4e-65; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 29227187 - 29227415
Alignment:
| Q |
1 |
attaattcatttttatgcaggtgaatcaaaatctctacggggacaatcgccctagattatttatctattggaccgtaagtattttatacttgtttcaagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29227187 |
attaattcatttttatgcaggtgaatcaaaatctctacggagacaatcgccctagattgtttatctattggaccgtaagtattttatatttgtttcaagt |
29227286 |
T |
|
| Q |
101 |
gtaacatga--------nnnnnnnnngaggaaaagtgtaacatattcataatgaaaaaatttattacaaaaatttgactatagcaataattccaggctga |
192 |
Q |
| |
|
||||||||| ||| ||||||||||||||| ||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
29227287 |
gtaacatgattttttttttttttttttagg-aaagtgtaacatatttataatgaaaaaatttattaaatttttttgactatagcaataattccaggctga |
29227385 |
T |
|
| Q |
193 |
tggatatgaccaaaccggatgctacaattt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29227386 |
tggatatgaccaaaccggatgctacaattt |
29227415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 35 - 104
Target Start/End: Original strand, 29246501 - 29246570
Alignment:
| Q |
35 |
ctacggggacaatcgccctagattatttatctattggaccgtaagtattttatacttgtttcaagtgtaa |
104 |
Q |
| |
|
|||||||||||||||||||||||| |||| || |||||| ||||||| |||||| ||||||||||||||| |
|
|
| T |
29246501 |
ctacggggacaatcgccctagattgtttaccttttggactgtaagtaatttatatttgtttcaagtgtaa |
29246570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 33 - 107
Target Start/End: Original strand, 29254750 - 29254824
Alignment:
| Q |
33 |
ctctacggggacaatcgccctagattatttatctattggaccgtaagtattttatacttgtttcaagtgtaacat |
107 |
Q |
| |
|
|||||||||||||||| ||| ||||| || ||||||||||| ||||||| |||||| | ||||||||||||||| |
|
|
| T |
29254750 |
ctctacggggacaatctccccagattgttcatctattggacagtaagtaatttatattaatttcaagtgtaacat |
29254824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 177 - 222
Target Start/End: Original strand, 29246610 - 29246655
Alignment:
| Q |
177 |
aataattccaggctgatggatatgaccaaaccggatgctacaattt |
222 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29246610 |
aataattgcaggctgatggatatgaccaaaccggatgctacgattt |
29246655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 33 - 81
Target Start/End: Complemental strand, 43814286 - 43814238
Alignment:
| Q |
33 |
ctctacggggacaatcgccctagattatttatctattggaccgtaagta |
81 |
Q |
| |
|
|||||||||||||| ||||||||| | ||||| |||||||| ||||||| |
|
|
| T |
43814286 |
ctctacggggacaaccgccctagaatttttatttattggacggtaagta |
43814238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University