View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18563_low_41 (Length: 214)
Name: NF18563_low_41
Description: NF18563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18563_low_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 5 - 196
Target Start/End: Complemental strand, 26422464 - 26422273
Alignment:
| Q |
5 |
gatggacatcatcaaaattcccgcaaaacctgaagtaaagctcctcactcagaaaaaatttgtgcccatcatcaaaattccagcaactgactcctcccac |
104 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26422464 |
gatggccatcatcaaaattcccgcaaaacctgaagtaaagctcctcactcagaagaaatttgtgcccatcatcaaaattcccgcaactgactcctcccac |
26422365 |
T |
 |
| Q |
105 |
ttgacaccactattctcatatcgcccttttcaattttattcctccccaatattcacttttgtactccagattttagttccacttgcagtttc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26422364 |
ttgacaccactattctcatatcgcccttttcaattttattcctccccaatattcacttttgtactccagattttagttccacttgcagtttc |
26422273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University