View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18563_low_43 (Length: 204)
Name: NF18563_low_43
Description: NF18563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18563_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 17 - 188
Target Start/End: Complemental strand, 54647080 - 54646908
Alignment:
| Q |
17 |
acagacgtgaaattagtat-gctagcagagagaaccaagactgagggggcagagataaaataacaaccaatgccctggtttcttggatataaattcatac |
115 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |||| |
|
|
| T |
54647080 |
acagacgtgaaattagtgttgctagcagagagaaccaagactgagggggcagagataaaataacaacaaatgccctggtttcttggatatatatttatac |
54646981 |
T |
 |
| Q |
116 |
ttacaatcatacagtttctaagcggagaggggagttatatacaactacaagttggttggcaaataacataact |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54646980 |
ttacaatcatacagtttctaagcggagaggggagttatatacaactacaagttggttggcaaataacataact |
54646908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University