View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18564_low_10 (Length: 229)
Name: NF18564_low_10
Description: NF18564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18564_low_10 |
 |  |
|
| [»] scaffold0005 (2 HSPs) |
 |  |  |
|
| [»] scaffold0472 (1 HSPs) |
 |  |  |
|
| [»] scaffold0160 (1 HSPs) |
 |  |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 34)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 130 - 169
Target Start/End: Complemental strand, 44958509 - 44958470
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44958509 |
aaaggctaaaatatgattttggtccctacaaatatgtctc |
44958470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 129 - 169
Target Start/End: Complemental strand, 5234208 - 5234168
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5234208 |
taaaggctaaaatatggttttggtccctacaaatatgtctc |
5234168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 25092150 - 25092196
Alignment:
| Q |
123 |
attttgtaaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
25092150 |
attttttaaaggctaaaatatggttttggtccctgcaaatatgtctc |
25092196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 129 - 167
Target Start/End: Complemental strand, 36687267 - 36687229
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgtc |
167 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36687267 |
taaaggctaaaatatgattttggtccctgcaaatatgtc |
36687229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 129 - 169
Target Start/End: Original strand, 35104074 - 35104114
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
35104074 |
taaaggctaaaatataattttggtccctgcaaatatgtctc |
35104114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 133 - 169
Target Start/End: Complemental strand, 46759942 - 46759906
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
46759942 |
ggctaaaatatgattttggtccctgcaaatatgtctc |
46759906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 165
Target Start/End: Complemental strand, 2945848 - 2945813
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2945848 |
aaaggctaaaatatgtttttggtccctacaaatatg |
2945813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 169
Target Start/End: Original strand, 6911079 - 6911118
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
6911079 |
aaaggctaaaatatgattttggtccttataaatatgtctc |
6911118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 169
Target Start/End: Original strand, 8144292 - 8144331
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
8144292 |
aaaggctaaaatatggttttggtccctgcaaatatgtctc |
8144331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 169
Target Start/End: Original strand, 14543707 - 14543746
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
14543707 |
aaaggctaaaatatggttttggtccctgcaaatatgtctc |
14543746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 169
Target Start/End: Complemental strand, 23399979 - 23399940
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
23399979 |
aaaggctaaaatatggttttggtccctgcaaatatgtctc |
23399940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 169
Target Start/End: Original strand, 27458396 - 27458435
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
27458396 |
aaaggctaaaatatggttttggtccctgcaaatatgtctc |
27458435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 165
Target Start/End: Complemental strand, 6509484 - 6509438
Alignment:
| Q |
119 |
tattattttgtaaaggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
||||||||| | |||||||||||||| |||| ||||||||||||||| |
|
|
| T |
6509484 |
tattattttttcaaggctaaaatatggttttagtccctacaaatatg |
6509438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 169
Target Start/End: Original strand, 35837922 - 35837960
Alignment:
| Q |
131 |
aaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
35837922 |
aaggctaaaatatggttttggtccctgcaaatatgtctc |
35837960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 169
Target Start/End: Complemental strand, 39439035 - 39438993
Alignment:
| Q |
127 |
tgtaaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||| ||||| |
|
|
| T |
39439035 |
tgtaaaggctaaaatatggttttggtccctgcaaatacgtctc |
39438993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 1614558 - 1614595
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
1614558 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
1614595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 25988384 - 25988421
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
25988384 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
25988421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 30709645 - 30709608
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
30709645 |
aggctaaaatatgattttagtccctgcaaatatgtctc |
30709608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 35838338 - 35838301
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
35838338 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
35838301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 38486477 - 38486514
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38486477 |
aggctaaaatatgattttggtccctgtaaatatgtctc |
38486514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 46759657 - 46759694
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
46759657 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
46759694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 131 - 168
Target Start/End: Original strand, 46828942 - 46828979
Alignment:
| Q |
131 |
aaggctaaaatatgattttggtccctacaaatatgtct |
168 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
46828942 |
aaggctaaaatatggttttggtccctgcaaatatgtct |
46828979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 165
Target Start/End: Complemental strand, 1614908 - 1614872
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
1614908 |
taaaggctaaaatatggttttggtccctgcaaatatg |
1614872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 165
Target Start/End: Original strand, 3975545 - 3975581
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
3975545 |
taaaggctaaaatatggttttggtccctgcaaatatg |
3975581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 165
Target Start/End: Original strand, 5233804 - 5233840
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
5233804 |
taaaggctaaaatatggttttggtccctgcaaatatg |
5233840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 132 - 164
Target Start/End: Complemental strand, 5611567 - 5611535
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatat |
164 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
5611567 |
aggctaaaatatgattttggtccctgcaaatat |
5611535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 165
Target Start/End: Complemental strand, 9659693 - 9659657
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
9659693 |
taaaggctaaaatatggttttggtccctgcaaatatg |
9659657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Complemental strand, 24717532 - 24717496
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
24717532 |
ggctaaaatatggttttggtccctaccaatatgtctc |
24717496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 165
Target Start/End: Complemental strand, 25988753 - 25988717
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
25988753 |
taaaggctaaaatatggttttggtccctgcaaatatg |
25988717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 169
Target Start/End: Original strand, 30223457 - 30223497
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
30223457 |
taaaggctaaaatatggttttggtccccgcaaatatgtctc |
30223497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 169
Target Start/End: Complemental strand, 34878129 - 34878089
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||| ||||| ||||| |||||||||||| |
|
|
| T |
34878129 |
taaaggctaaaatatggttttgatccctgcaaatatgtctc |
34878089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 169
Target Start/End: Original strand, 39520394 - 39520434
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||| ||||||||| | |||||||||||| |
|
|
| T |
39520394 |
taaaggctaaaatatggttttggtccatccaaatatgtctc |
39520434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 169
Target Start/End: Complemental strand, 44568694 - 44568654
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||| ||||| ||||| |||||||||||| |
|
|
| T |
44568694 |
taaaggctaaaatatggttttgatccctgcaaatatgtctc |
44568654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 130 - 166
Target Start/End: Complemental strand, 48854073 - 48854037
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgt |
166 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
48854073 |
aaaggctaaaatatgattttgatccctgcaaatatgt |
48854037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 39)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 129 - 169
Target Start/End: Complemental strand, 20984514 - 20984474
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20984514 |
taaaggctaaaatatggttttggtccctacaaatatgtctc |
20984474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 130 - 169
Target Start/End: Original strand, 2728229 - 2728268
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2728229 |
aaaggctaaaatatgattttggtccctgcaaatatgtctc |
2728268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 131 - 168
Target Start/End: Complemental strand, 28324183 - 28324146
Alignment:
| Q |
131 |
aaggctaaaatatgattttggtccctacaaatatgtct |
168 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28324183 |
aaggctaaaatatggttttggtccctacaaatatgtct |
28324146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 129 - 169
Target Start/End: Complemental strand, 8298979 - 8298939
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
8298979 |
taaaggctaaaatatggttttggtccctgcaaatatgtctc |
8298939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 129 - 169
Target Start/End: Original strand, 9175008 - 9175048
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
9175008 |
taaaggctaaaatatgattttggtccttgcaaatatgtctc |
9175048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 32195280 - 32195316
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32195280 |
ggctaaaatatggttttggtccctacaaatatgtctc |
32195316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 129 - 169
Target Start/End: Original strand, 32725903 - 32725943
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
32725903 |
taaaggctaaaatatggttttggtccctgcaaatatgtctc |
32725943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 129 - 165
Target Start/End: Original strand, 44997927 - 44997963
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44997927 |
taaaggctaaaatatgattttggtccctgcaaatatg |
44997963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 169
Target Start/End: Original strand, 7420227 - 7420266
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
7420227 |
aaaggctaaaatatggttttggtccctgcaaatatgtctc |
7420266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 134 - 169
Target Start/End: Original strand, 15930933 - 15930968
Alignment:
| Q |
134 |
gctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
15930933 |
gctaaaatatgattttggttcctacaaatatgtctc |
15930968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 169
Target Start/End: Complemental strand, 24187900 - 24187861
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
24187900 |
aaaggctaaaatatgattttagtccctgcaaatatgtctc |
24187861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 165
Target Start/End: Original strand, 28497252 - 28497287
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28497252 |
aaaggctaaaatatgattttggtccctgcaaatatg |
28497287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 169
Target Start/End: Original strand, 11019518 - 11019556
Alignment:
| Q |
131 |
aaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
11019518 |
aaggctaaaatatggttttggtccctgcaaatatgtctc |
11019556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 165
Target Start/End: Original strand, 39439922 - 39439956
Alignment:
| Q |
131 |
aaggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
39439922 |
aaggctaaaatatgattttggtccctgcaaatatg |
39439956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 165
Target Start/End: Original strand, 42429756 - 42429790
Alignment:
| Q |
131 |
aaggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
42429756 |
aaggctaaaatatggttttggtccctacaaatatg |
42429790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 3512267 - 3512230
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
3512267 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
3512230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 165
Target Start/End: Original strand, 5357422 - 5357455
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
5357422 |
aggctaaaatatgattttggtccctgcaaatatg |
5357455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 9496340 - 9496377
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
9496340 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
9496377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 131 - 164
Target Start/End: Original strand, 10292814 - 10292847
Alignment:
| Q |
131 |
aaggctaaaatatgattttggtccctacaaatat |
164 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
10292814 |
aaggctaaaatatgattttggtcccttcaaatat |
10292847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 10337118 - 10337155
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
10337118 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
10337155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 17073806 - 17073843
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
17073806 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
17073843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 17574464 - 17574427
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
17574464 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
17574427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 25600229 - 25600266
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
25600229 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
25600266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 25702810 - 25702773
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
25702810 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
25702773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 35097327 - 35097364
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
35097327 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
35097364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 35346999 - 35346962
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
35346999 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
35346962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 1778564 - 1778600
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
1778564 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
1778600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Complemental strand, 7186004 - 7185968
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
7186004 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
7185968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 8298587 - 8298623
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
8298587 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
8298623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 165
Target Start/End: Original strand, 11976369 - 11976405
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
11976369 |
taaaggctaaaatatggttttggtccctgcaaatatg |
11976405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Complemental strand, 14489073 - 14489037
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
14489073 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
14489037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 165
Target Start/End: Original strand, 20984142 - 20984178
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
20984142 |
taaaggctaaaatatggttttggtccctgcaaatatg |
20984178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 169
Target Start/End: Original strand, 22650460 - 22650500
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||| |||| |||||| |||||||||||| |
|
|
| T |
22650460 |
taaaggctaaaatatggttttagtccctgcaaatatgtctc |
22650500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 165
Target Start/End: Complemental strand, 27117980 - 27117944
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
27117980 |
taaaggctaaaatatggttttggtccctgcaaatatg |
27117944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Complemental strand, 34963664 - 34963628
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
34963664 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
34963628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 35346629 - 35346665
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
35346629 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
35346665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 42132864 - 42132900
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
42132864 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
42132900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Complemental strand, 42133154 - 42133118
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
42133154 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
42133118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Complemental strand, 42430120 - 42430084
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
42430120 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
42430084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000005; HSPs: 20)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 129 - 169
Target Start/End: Complemental strand, 17765379 - 17765339
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17765379 |
taaaggctaaaatatgattttggtccctgcaaatatgtctc |
17765339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 132 - 165
Target Start/End: Complemental strand, 24901555 - 24901522
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
24901555 |
aggctaaaatatgattttggtccctacaaatatg |
24901522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 169
Target Start/End: Original strand, 17765006 - 17765045
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
17765006 |
aaaggctaaaatatggttttggtccctgcaaatatgtctc |
17765045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 132 - 167
Target Start/End: Complemental strand, 19129521 - 19129486
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtc |
167 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19129521 |
aggctaaaatatgattttggtccctgcaaatatgtc |
19129486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 169
Target Start/End: Original strand, 19690390 - 19690429
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
19690390 |
aaaggctaaaatatggttttggtccctgcaaatatgtctc |
19690429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 169
Target Start/End: Original strand, 21385248 - 21385287
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
21385248 |
aaaggctaaaatatggttttggtccctgcaaatatgtctc |
21385287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 169
Target Start/End: Complemental strand, 3276356 - 3276318
Alignment:
| Q |
131 |
aaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
3276356 |
aaggctaaaatatggttttggtccctgcaaatatgtctc |
3276318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 169
Target Start/End: Original strand, 3968643 - 3968681
Alignment:
| Q |
131 |
aaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
3968643 |
aaggctaaaatatggttttggtccctgcaaatatgtctc |
3968681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 169
Target Start/End: Original strand, 11448535 - 11448573
Alignment:
| Q |
131 |
aaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
11448535 |
aaggctaaaatatgattttagtccctgcaaatatgtctc |
11448573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 169
Target Start/End: Original strand, 12757608 - 12757646
Alignment:
| Q |
131 |
aaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
12757608 |
aaggctaaaatatggttttggtccctgcaaatatgtctc |
12757646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 165
Target Start/End: Complemental strand, 21385598 - 21385552
Alignment:
| Q |
119 |
tattattttgtaaaggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
21385598 |
tattattttaaaaaggctaaaatatggttttggtccctgcaaatatg |
21385552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 169
Target Start/End: Complemental strand, 31398543 - 31398505
Alignment:
| Q |
131 |
aaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
31398543 |
aaggctaaaatatgattttagtccctgcaaatatgtctc |
31398505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 6412217 - 6412254
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
6412217 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
6412254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 8170152 - 8170115
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
8170152 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
8170115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 10910965 - 10910928
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
10910965 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
10910928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 22543719 - 22543682
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
22543719 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
22543682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 10910629 - 10910665
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
10910629 |
ggctaaaatatggttttggtctctacaaatatgtctc |
10910665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 11925739 - 11925775
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
11925739 |
ggctaatatatgattttggtccctgcaaatatgtctc |
11925775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 132 - 168
Target Start/End: Complemental strand, 18024376 - 18024340
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtct |
168 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
18024376 |
aggctaaaatatggttttggtccctgcaaatatgtct |
18024340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 24901239 - 24901275
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
24901239 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
24901275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000005; HSPs: 34)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 129 - 169
Target Start/End: Original strand, 47114483 - 47114523
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47114483 |
taaaggctaaaatatgattttggtccctgcaaatatgtctc |
47114523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 130 - 169
Target Start/End: Original strand, 35177252 - 35177291
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35177252 |
aaaggctaaaatatgattttggtccctgcaaatatgtctc |
35177291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 131 - 169
Target Start/End: Original strand, 38232239 - 38232277
Alignment:
| Q |
131 |
aaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38232239 |
aaggctaaaatatgattttggtccctgcaaatatgtctc |
38232277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 15979702 - 15979665
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15979702 |
aggctaaaatatggttttggtccctacaaatatgtctc |
15979665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 40370285 - 40370321
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40370285 |
ggctaaaatatgattttggtccctgcaaatatgtctc |
40370321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 129 - 169
Target Start/End: Complemental strand, 44802552 - 44802512
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
44802552 |
taaaggctaaaatatgattttgatccctgcaaatatgtctc |
44802512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 122 - 169
Target Start/End: Complemental strand, 474419 - 474372
Alignment:
| Q |
122 |
tattttgtaaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||| |||| ||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
474419 |
tattatgtataggctaaaatatggttttggtccctgcaaatatgtctc |
474372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 169
Target Start/End: Complemental strand, 12741274 - 12741235
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
12741274 |
aaaggctaaaatatggttttggtccctgcaaatatgtctc |
12741235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 165
Target Start/End: Complemental strand, 32119587 - 32119552
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32119587 |
aaaggctaaaatatgattttggtccctgcaaatatg |
32119552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 129 - 164
Target Start/End: Complemental strand, 40477437 - 40477402
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatat |
164 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40477437 |
taaaggctaaaatatgattttggtccctgcaaatat |
40477402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 169
Target Start/End: Original strand, 53113440 - 53113479
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
53113440 |
aaaggctaaaatatggttttggtccctgcaaatatgtctc |
53113479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 169
Target Start/End: Original strand, 474042 - 474080
Alignment:
| Q |
131 |
aaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
474042 |
aaggctaaaatatggttttggtccctgcaaatatgtctc |
474080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 169
Target Start/End: Original strand, 47005152 - 47005190
Alignment:
| Q |
131 |
aaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
47005152 |
aaggctaaaatatggttttggtccctgcaaatatgtctc |
47005190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 54608873 - 54608827
Alignment:
| Q |
123 |
attttgtaaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||| || ||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
54608873 |
attttttataggctaaaatatggttttggtccctgcaaatatgtctc |
54608827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 863280 - 863317
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
863280 |
aggctaaaatatgattttggtccatgcaaatatgtctc |
863317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 12740906 - 12740943
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
12740906 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
12740943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 13514578 - 13514541
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
13514578 |
aggctaaaatatgattttggtacctgcaaatatgtctc |
13514541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 165
Target Start/End: Complemental strand, 28452377 - 28452344
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
28452377 |
aggctaaaatatggttttggtccctacaaatatg |
28452344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 29490744 - 29490707
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
29490744 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
29490707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 131 - 164
Target Start/End: Original strand, 35936778 - 35936811
Alignment:
| Q |
131 |
aaggctaaaatatgattttggtccctacaaatat |
164 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
35936778 |
aaggctaaaatatggttttggtccctacaaatat |
35936811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 136 - 169
Target Start/End: Complemental strand, 40545836 - 40545803
Alignment:
| Q |
136 |
taaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
40545836 |
taaaatatgattttggtccctgcaaatatgtctc |
40545803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 131 - 164
Target Start/End: Complemental strand, 44507860 - 44507827
Alignment:
| Q |
131 |
aaggctaaaatatgattttggtccctacaaatat |
164 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
44507860 |
aaggctaaaatatgattttggtccctgcaaatat |
44507827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 47336582 - 47336545
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
47336582 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
47336545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 51550447 - 51550410
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
51550447 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
51550410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 4034717 - 4034753
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
4034717 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
4034753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 165
Target Start/End: Complemental strand, 7957226 - 7957194
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
7957226 |
ggctaaaatatgattttggtccctgcaaatatg |
7957194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 165
Target Start/End: Original strand, 9261789 - 9261821
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
9261789 |
ggctaaaatatgattttggtccctgcaaatatg |
9261821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 165
Target Start/End: Original strand, 19844265 - 19844297
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
19844265 |
ggctaaaatatggttttggtccctacaaatatg |
19844297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 165
Target Start/End: Original strand, 25615971 - 25616007
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
25615971 |
taaaggctaaaatatggttttggtccctgcaaatatg |
25616007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Complemental strand, 26090078 - 26090042
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
26090078 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
26090042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 165
Target Start/End: Complemental strand, 29678387 - 29678355
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
29678387 |
ggctaaaatatgattttggtccctgcaaatatg |
29678355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Complemental strand, 35533618 - 35533582
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
35533618 |
ggctaaaatatgattttgctccctacacatatgtctc |
35533582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 169
Target Start/End: Original strand, 39436714 - 39436754
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||| |||| |||||| |||||||||||| |
|
|
| T |
39436714 |
taaaggctaaaatatggttttagtccctgcaaatatgtctc |
39436754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 43441270 - 43441306
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
43441270 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
43441306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 29)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 42823775 - 42823812
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42823775 |
aggctaaaatatgattttggtccctgcaaatatgtctc |
42823812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 51738136 - 51738173
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51738136 |
aggctaaaatatggttttggtccctacaaatatgtctc |
51738173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 129 - 169
Target Start/End: Complemental strand, 14791810 - 14791770
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
14791810 |
taaaggctaaaatatggttttggtccctgcaaatatgtctc |
14791770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 129 - 169
Target Start/End: Original strand, 43231084 - 43231124
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
43231084 |
taaaggctaaaatatggttttggtccctgcaaatatgtctc |
43231124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 169
Target Start/End: Complemental strand, 25424315 - 25424276
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
25424315 |
aaaggctaaaatatggttttggtccctgcaaatatgtctc |
25424276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 134 - 168
Target Start/End: Original strand, 7639897 - 7639931
Alignment:
| Q |
134 |
gctaaaatatgattttggtccctacaaatatgtct |
168 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7639897 |
gctaaaatatggttttggtccctacaaatatgtct |
7639931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 169
Target Start/End: Original strand, 25423922 - 25423960
Alignment:
| Q |
131 |
aaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
25423922 |
aaggctaaaatatggttttggtccctgcaaatatgtctc |
25423960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 42848017 - 42848063
Alignment:
| Q |
123 |
attttgtaaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||| |||||||||||||||| ||||||| ||| |||||||||||| |
|
|
| T |
42848017 |
attttttaaaggctaaaatatggttttggttcctgcaaatatgtctc |
42848063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 136 - 169
Target Start/End: Complemental strand, 5797817 - 5797784
Alignment:
| Q |
136 |
taaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
5797817 |
taaaatatggttttggtccctacaaatatgtctc |
5797784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 11693122 - 11693085
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
11693122 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
11693085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 12152494 - 12152457
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
12152494 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
12152457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 13631227 - 13631264
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
13631227 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
13631264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 14488188 - 14488151
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
14488188 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
14488151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 14594205 - 14594242
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
14594205 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
14594242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 124 - 165
Target Start/End: Original strand, 16573369 - 16573410
Alignment:
| Q |
124 |
ttttgtaaaggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
16573369 |
ttttttaaaggctaaaatatgcttttggtctctacaaatatg |
16573410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 165
Target Start/End: Original strand, 20291985 - 20292018
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
20291985 |
aggctaaaatatgattttggtccctgcaaatatg |
20292018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 29420538 - 29420501
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
29420538 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
29420501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 35464017 - 35464054
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
35464017 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
35464054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 53916048 - 53916011
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
53916048 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
53916011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 5827655 - 5827691
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
5827655 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
5827691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 13073759 - 13073795
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
13073759 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
13073795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 165
Target Start/End: Complemental strand, 13530717 - 13530681
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
13530717 |
taaaggctaaaatatggttttggtccctgcaaatatg |
13530681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 13764613 - 13764649
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
13764613 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
13764649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Complemental strand, 25358540 - 25358504
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25358540 |
ggctaaaatatgattttggtccctgtaaatatgtctc |
25358504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 165
Target Start/End: Original strand, 29499178 - 29499214
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
29499178 |
taaaggctaaaatatggttttggtccctgcaaatatg |
29499214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 165
Target Start/End: Complemental strand, 30046796 - 30046760
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
30046796 |
taaaggctaaaatatggttttggtccctgcaaatatg |
30046760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 165
Target Start/End: Complemental strand, 30061137 - 30061101
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
30061137 |
taaaggctaaaatatggttttggtccctgcaaatatg |
30061101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Complemental strand, 31560695 - 31560659
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
31560695 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
31560659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 165
Target Start/End: Complemental strand, 43231393 - 43231357
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
43231393 |
taaaggctaaaatatggttttggtccctgcaaatatg |
43231357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 21)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 129 - 166
Target Start/End: Complemental strand, 43672322 - 43672285
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgt |
166 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43672322 |
taaaggctaaaatatgattttggtccctgcaaatatgt |
43672285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 129 - 169
Target Start/End: Original strand, 31644837 - 31644877
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
31644837 |
taaaggctaaaatatggttttggtccctgcaaatatgtctc |
31644877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 165
Target Start/End: Original strand, 3172017 - 3172052
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3172017 |
aaaggctaaaatatgattttggtccctgcaaatatg |
3172052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 169
Target Start/End: Original strand, 16673408 - 16673447
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
16673408 |
aaaggctaaaatatggttttggtccctgcaaatatgtctc |
16673447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 169
Target Start/End: Original strand, 25705082 - 25705121
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
25705082 |
aaaggctaaaatatggttttggtccctgcaaatatgtctc |
25705121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 169
Target Start/End: Complemental strand, 4424187 - 4424149
Alignment:
| Q |
131 |
aaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
4424187 |
aaggctaaaatatggttttggtccctgcaaatatgtctc |
4424149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 169
Target Start/End: Complemental strand, 33576119 - 33576081
Alignment:
| Q |
131 |
aaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
33576119 |
aaggctaaaatatggttttggtccctgcaaatatgtctc |
33576081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 165
Target Start/End: Complemental strand, 40125291 - 40125257
Alignment:
| Q |
131 |
aaggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
40125291 |
aaggctaaaatatgattttggtccctgcaaatatg |
40125257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 13215059 - 13215096
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
13215059 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
13215096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 20131316 - 20131353
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
20131316 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
20131353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 129 - 166
Target Start/End: Original strand, 29182164 - 29182201
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgt |
166 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
29182164 |
taaaggctaaaatatgattttggtccttgcaaatatgt |
29182201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 41451836 - 41451873
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
41451836 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
41451873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 44559061 - 44559098
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
44559061 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
44559098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 165
Target Start/End: Complemental strand, 18113454 - 18113422
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
18113454 |
ggctaaaatatggttttggtccctacaaatatg |
18113422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 23732039 - 23732075
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
23732039 |
ggctaaaatatgattttgatccctgcaaatatgtctc |
23732075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 165
Target Start/End: Original strand, 27109073 - 27109105
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
27109073 |
ggctaaaatatggttttggtccctacaaatatg |
27109105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 165
Target Start/End: Original strand, 34317798 - 34317830
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
34317798 |
ggctaaaatatgattttggtccctgcaaatatg |
34317830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 165
Target Start/End: Complemental strand, 34318083 - 34318051
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
34318083 |
ggctaaaatatggttttggtccctacaaatatg |
34318051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Complemental strand, 34964159 - 34964123
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
34964159 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
34964123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 130 - 166
Target Start/End: Original strand, 37228730 - 37228766
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgt |
166 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
37228730 |
aaaggctaaaatatggttttggtccctgcaaatatgt |
37228766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 42695868 - 42695904
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
42695868 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
42695904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 129 - 169
Target Start/End: Original strand, 47921 - 47961
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
47921 |
taaaggctaaaatatggttttggtccctgcaaatatgtctc |
47961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 223173 - 223136
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
223173 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
223136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 21)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 129 - 169
Target Start/End: Complemental strand, 37271710 - 37271670
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
37271710 |
taaaggctaaaatatggttttggtccctgcaaatatgtctc |
37271670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 42553642 - 42553678
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42553642 |
ggctaaaatatgattttggtccctgcaaatatgtctc |
42553678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 169
Target Start/End: Original strand, 1381244 - 1381283
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
1381244 |
aaaggctaaaatatggttttggtccctgcaaatatgtctc |
1381283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 169
Target Start/End: Original strand, 17070532 - 17070571
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
17070532 |
aaaggctaaaatatggttttggtccctgcaaatatgtctc |
17070571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 169
Target Start/End: Complemental strand, 18258530 - 18258491
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
18258530 |
aaaggctaaaatatggttttggtccctgcaaatatgtctc |
18258491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 169
Target Start/End: Original strand, 19565465 - 19565503
Alignment:
| Q |
131 |
aaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
19565465 |
aaggctaaaatatggttttggtccctgcaaatatgtctc |
19565503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 130 - 164
Target Start/End: Complemental strand, 27571191 - 27571157
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatat |
164 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27571191 |
aaaggctaaaatatgattttggtccctgcaaatat |
27571157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 130 - 164
Target Start/End: Complemental strand, 34911890 - 34911856
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatat |
164 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34911890 |
aaaggctaaaatatgattttggtccctgcaaatat |
34911856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 5917125 - 5917162
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
5917125 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
5917162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 165
Target Start/End: Original strand, 15599764 - 15599797
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
15599764 |
aggctaaaatatgcttttggtccctacaaatatg |
15599797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 17070864 - 17070827
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
17070864 |
aggctaaaatatggttttagtccctacaaatatgtctc |
17070827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 19685016 - 19685053
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
19685016 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
19685053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 20690732 - 20690769
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
20690732 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
20690769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 35877053 - 35877016
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
35877053 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
35877016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 45138 - 45174
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
45138 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
45174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 165
Target Start/End: Original strand, 21050575 - 21050607
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
21050575 |
ggctaaaatatgattttagtccctacaaatatg |
21050607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 169
Target Start/End: Complemental strand, 26071620 - 26071580
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||| ||||||||||||||| ||||| |||||||||||| |
|
|
| T |
26071620 |
taaaggttaaaatatgattttgatccctgcaaatatgtctc |
26071580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 169
Target Start/End: Complemental strand, 26133417 - 26133377
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||| |||| |||||| |||||||||||| |
|
|
| T |
26133417 |
taaaggctaaaatatggttttagtccctgcaaatatgtctc |
26133377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 30888160 - 30888196
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
30888160 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
30888196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Complemental strand, 35928458 - 35928422
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
35928458 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
35928422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 165
Target Start/End: Complemental strand, 40038858 - 40038826
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
40038858 |
ggctaaaatatgattttggtccctgcaaatatg |
40038826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 38)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 20948755 - 20948791
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20948755 |
ggctaaaatatggttttggtccctacaaatatgtctc |
20948791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 129 - 169
Target Start/End: Complemental strand, 33000673 - 33000633
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
33000673 |
taaaggctaaaatatggttttggtccctgcaaatatgtctc |
33000633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 169
Target Start/End: Original strand, 3247195 - 3247234
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
3247195 |
aaaggctaaaatatggttttggtccctgcaaatatgtctc |
3247234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 169
Target Start/End: Original strand, 19720709 - 19720748
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
19720709 |
aaaggctaaaatatggttttggtccctgcaaatatgtctc |
19720748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 169
Target Start/End: Complemental strand, 24654170 - 24654131
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
24654170 |
aaaggctaaaatatggttttggtccctgcaaatatgtctc |
24654131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 169
Target Start/End: Original strand, 30322926 - 30322965
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
30322926 |
aaaggctaaaatatggttttggtccctgcaaatatgtctc |
30322965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 169
Target Start/End: Original strand, 34002632 - 34002671
Alignment:
| Q |
130 |
aaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
34002632 |
aaaggctaaagtatgattttggtccctgcaaatatgtctc |
34002671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 169
Target Start/End: Complemental strand, 12360970 - 12360932
Alignment:
| Q |
131 |
aaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
12360970 |
aaggctaaaatatggttttggtccctgcaaatatgtctc |
12360932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 169
Target Start/End: Complemental strand, 15526364 - 15526326
Alignment:
| Q |
131 |
aaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
15526364 |
aaggctaaaatatggttttggtccctgcaaatatgtctc |
15526326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 123 - 165
Target Start/End: Complemental strand, 33234922 - 33234880
Alignment:
| Q |
123 |
attttgtaaaggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
33234922 |
attttttaatggctaaaatatgattttggtccctgcaaatatg |
33234880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 131 - 168
Target Start/End: Complemental strand, 7867359 - 7867322
Alignment:
| Q |
131 |
aaggctaaaatatgattttggtccctacaaatatgtct |
168 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
7867359 |
aaggctaaaatatggttttggtccctgcaaatatgtct |
7867322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 8140433 - 8140470
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
8140433 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
8140470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 10887599 - 10887562
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
10887599 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
10887562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 165
Target Start/End: Original strand, 26324584 - 26324617
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
26324584 |
aggctaaaatatgattttggtccctgcaaatatg |
26324617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 165
Target Start/End: Complemental strand, 30323294 - 30323261
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
30323294 |
aggctaaaatatgattttggtccctgcaaatatg |
30323261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 136 - 169
Target Start/End: Original strand, 31404429 - 31404462
Alignment:
| Q |
136 |
taaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
31404429 |
taaaatatgattttggtccctgcaaatatgtctc |
31404462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 31404723 - 31404686
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
31404723 |
aggctaaaatatggttttggtccctacaaacatgtctc |
31404686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 165
Target Start/End: Complemental strand, 35056895 - 35056862
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
35056895 |
aggctaaaatatgattttggtccctgcaaatatg |
35056862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 36912852 - 36912889
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
36912852 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
36912889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 39747836 - 39747799
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
39747836 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
39747799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 42482978 - 42483015
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
42482978 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
42483015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 45380271 - 45380308
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
45380271 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
45380308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 45638895 - 45638858
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
45638895 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
45638858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 10631164 - 10631200
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
10631164 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
10631200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Complemental strand, 12322970 - 12322934
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
12322970 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
12322934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 169
Target Start/End: Complemental strand, 17130087 - 17130047
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||| |||||||||| ||||||||||| |||||||||||| |
|
|
| T |
17130087 |
taaagactaaaatatggttttggtccctgcaaatatgtctc |
17130047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 24977778 - 24977814
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
24977778 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
24977814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 132 - 164
Target Start/End: Complemental strand, 27264276 - 27264244
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatat |
164 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
27264276 |
aggctaaaatatgattttggtccctgcaaatat |
27264244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 132 - 168
Target Start/End: Complemental strand, 32035789 - 32035753
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtct |
168 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
32035789 |
aggctaaaatatggttttggtccctgcaaatatgtct |
32035753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 35056530 - 35056566
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
35056530 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
35056566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 165
Target Start/End: Complemental strand, 38136981 - 38136949
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
38136981 |
ggctaaaatatgattttggtccctgcaaatatg |
38136949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 40718110 - 40718146
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
40718110 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
40718146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 169
Target Start/End: Original strand, 45290453 - 45290493
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||| |||| |||||| |||||||||||| |
|
|
| T |
45290453 |
taaaggctaaaatatggttttagtccctgcaaatatgtctc |
45290493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 165
Target Start/End: Complemental strand, 45380636 - 45380604
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
45380636 |
ggctaaaatatgattttggtccctgcaaatatg |
45380604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 165
Target Start/End: Complemental strand, 47819600 - 47819564
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatg |
165 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
47819600 |
taaaggctaaaatatggttttggtccctgcaaatatg |
47819564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 132 - 164
Target Start/End: Complemental strand, 48334192 - 48334160
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatat |
164 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
48334192 |
aggctaaaatatgcttttggtccctacaaatat |
48334160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 169
Target Start/End: Original strand, 49073687 - 49073727
Alignment:
| Q |
129 |
taaaggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||| ||||||||| | |||||||||||| |
|
|
| T |
49073687 |
taaaggctaaaatatggttttggtccttgcaaatatgtctc |
49073727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 167
Target Start/End: Complemental strand, 51986584 - 51986540
Alignment:
| Q |
123 |
attttgtaaaggctaaaatatgattttggtccctacaaatatgtc |
167 |
Q |
| |
|
||||| |||||| ||||||||| |||| ||||||||||||||||| |
|
|
| T |
51986584 |
attttttaaaggttaaaatatggtttttgtccctacaaatatgtc |
51986540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0472 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0472
Description:
Target: scaffold0472; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 131 - 168
Target Start/End: Complemental strand, 7266 - 7229
Alignment:
| Q |
131 |
aaggctaaaatatgattttggtccctacaaatatgtct |
168 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
7266 |
aaggctaaaatatgattttggtctctgcaaatatgtct |
7229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 27365 - 27328
Alignment:
| Q |
132 |
aggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
27365 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
27328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 16724 - 16760
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
16724 |
ggctaaaatatgattttggtccctgcaaatatatctc |
16760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Complemental strand, 2883 - 2847
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
2883 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
2847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Complemental strand, 148282 - 148246
Alignment:
| Q |
133 |
ggctaaaatatgattttggtccctacaaatatgtctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
148282 |
ggctaaaatatggttttggtccctgcaaatatgtctc |
148246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University