View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18565_high_41 (Length: 293)
Name: NF18565_high_41
Description: NF18565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18565_high_41 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 6 - 108
Target Start/End: Complemental strand, 5175714 - 5175612
Alignment:
| Q |
6 |
agaagctagaaatgggtgttgttcgaaaatgttacggtgagttagaaattggcagagggtccttccttggcaagagagatatgagtaaggatgaggcttc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5175714 |
agaagctagaaatgggtgttgttcgaaaatgttacggtgagttagaaattggcagagggtccttccttggcaagagagatatgagtaaggatgaggcttc |
5175615 |
T |
|
| Q |
106 |
ctt |
108 |
Q |
| |
|
||| |
|
|
| T |
5175614 |
ctt |
5175612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 224
Target Start/End: Complemental strand, 5175115 - 5175027
Alignment:
| Q |
132 |
tgtcaaggat-atgcgattccttgatggcggcggtcacctccttactccaacaagcttattcacattttcagcctagacaaggttttaccaagt |
224 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5175115 |
tgtcaaggattatgcgattccttgatggcgg---tcacctccttactccaacaa-cttattcacattttcagcctagacaa-gttttaccaagt |
5175027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 7e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 6 - 85
Target Start/End: Complemental strand, 5179391 - 5179312
Alignment:
| Q |
6 |
agaagctagaaatgggtgttgttcgaaaatgttacggtgagttagaaattggcagagggtccttccttggcaagagagat |
85 |
Q |
| |
|
||||||| |||||| ||| ||| ||||||||||| ||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5179391 |
agaagctggaaatgagtgatgtccgaaaatgttatggtgagtcagaaattggcagagggtccttccttggcaggagagat |
5179312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University