View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18565_low_30 (Length: 374)
Name: NF18565_low_30
Description: NF18565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18565_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 2e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 229 - 357
Target Start/End: Original strand, 47965277 - 47965405
Alignment:
| Q |
229 |
tatgcaaaaatatcgtcgatgttcaatttttggcgtaggaatagcgtacaatttcgtcgctgtttcaatggggaacccgttgagtaataatccaatctgc |
328 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
47965277 |
tatgcaaacatatcgtcaatgttcaatttttggcgtaggaatagcgtacaatttcgtcgctgtttcaatggggaacccgttgagtaataatccaatccgc |
47965376 |
T |
 |
| Q |
329 |
cattcaccattttggttaatgaaagttct |
357 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47965377 |
cattcaccattttggttaatgaaagttct |
47965405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 11 - 113
Target Start/End: Original strand, 47965176 - 47965278
Alignment:
| Q |
11 |
catcatcaagctgagttttgagaacaacataagcagaattcgacatcacttgtcggctgataacaaattgcaagagtctaaacaaaacaccttaccctct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47965176 |
catcatcaagctgagttttgagaacaacataaccagaattcgacatcacttgtcggctgataacaaattgcaagagtctaaacaaaacacctcaccctct |
47965275 |
T |
 |
| Q |
111 |
cta |
113 |
Q |
| |
|
||| |
|
|
| T |
47965276 |
cta |
47965278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University