View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18565_low_45 (Length: 271)
Name: NF18565_low_45
Description: NF18565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18565_low_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 214
Target Start/End: Original strand, 47964944 - 47965140
Alignment:
| Q |
18 |
atgtatccaaagttgcaaagtgaataataacttttgcaggagaaacagggaaatgtttaaaattattagatttttcgtgttaaagtttttactatttatg |
117 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47964944 |
atgtatccaaagttgaaaagtgaataataacttttgcaggagaaacagggaaatgtttaaaattattagatttttcgtgttaaagtttttactatttatg |
47965043 |
T |
 |
| Q |
118 |
tttctatttgttctaaatgtatatgcgttgttttaaattgaaattcaataaaaatatattactgtttgtcacacacatcaccacctttagaattgat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47965044 |
tttctatttgttctaaatgtatatgcgttgttttaaattgaaattcaataaaaatatattaatgtttgtcacacacatcaccacctttagaattgat |
47965140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 234 - 271
Target Start/End: Original strand, 47965140 - 47965177
Alignment:
| Q |
234 |
tctcatataattgttggaacaccggtgtctagggatca |
271 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
47965140 |
tctcatgtaattgttggaacaccggtgtctcgggatca |
47965177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University