View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18565_low_46 (Length: 250)
Name: NF18565_low_46
Description: NF18565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18565_low_46 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 59; Significance: 4e-25; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 3391704 - 3391642
Alignment:
| Q |
1 |
ctagaagaaaaacttttcaaaagacaaatttgtgaaaatagctctctattgcctttaagtttt |
63 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3391704 |
ctagaagaaaaacttttcaacagacaaatttgtgaaaatagctctctattgcctttaagtttt |
3391642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 3298811 - 3298755
Alignment:
| Q |
1 |
ctagaagaaaaacttttcaaaagacaaatttgtgaaaatagctctctattgcctttaagtttt |
63 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3298811 |
ctagaagaaaaacttttcaacagacaaatttgtgaaaa------tctattgcctttaagtttt |
3298755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 129 - 162
Target Start/End: Complemental strand, 3391567 - 3391534
Alignment:
| Q |
129 |
gatcatgtttttgttacggattagaataaaagtg |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
3391567 |
gatcatgtttttgttacggattagaataaaagtg |
3391534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University