View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18565_low_56 (Length: 215)
Name: NF18565_low_56
Description: NF18565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18565_low_56 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 22 - 195
Target Start/End: Original strand, 16068925 - 16069098
Alignment:
| Q |
22 |
attgtgacatttttgcaattaacataaaaccttgaaatgacatgcttcctttgaagtcgggaacattaatggcttgactgatattaccttaacccggttt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
16068925 |
attgtgacatttttgcaattaacataaaaccttgaaatgacatgcttcctttgaagtcgggaacattactggcttgactgatattaccttaacccggttt |
16069024 |
T |
 |
| Q |
122 |
ttctagtaacaaggttattaacatctcatagcgtccttttatcctcagtgcgaatcctacctttttcttgtata |
195 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
16069025 |
ttctagtaacaaggttataaacatctcatagcgtccttttatcctcactgcgaatcctacttttttcttgtata |
16069098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University