View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18565_low_57 (Length: 213)
Name: NF18565_low_57
Description: NF18565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18565_low_57 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 18 - 198
Target Start/End: Original strand, 5220900 - 5221080
Alignment:
| Q |
18 |
gttagaacttacaataatcaacgagaactactaataataattcaccaatataacgagaatcaacctgagatagacgaaggagcgcacaagccgcgttctc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5220900 |
gttagaacttacaataatcaacgagaactactaataataattcaccaatataacgagaatcaacctgagatagacgaaggagcgcacaagccgcgttctc |
5220999 |
T |
 |
| Q |
118 |
tttagctgttgatgttcctgaatttaacgctctaactaacggtttaatagctccggaagaagctattagttctttattttc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5221000 |
tttagctgttgatgttcctgaatttaacgctctaactaacggtttaatagctccggaagaagctattagttctttattttc |
5221080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University