View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18566_high_10 (Length: 302)
Name: NF18566_high_10
Description: NF18566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18566_high_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 16 - 294
Target Start/End: Complemental strand, 14171788 - 14171510
Alignment:
| Q |
16 |
gcttccactttatccataaattgaattctttctagctcttccagatccagtctcttaacaatcactttgtttggtttgacaaagaatttggataataggg |
115 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14171788 |
gcttccacttcatccataaattgaattctttctagctcttccagatccagtctcttaacaatcactttgtttggtttgacaaagaatttggataataggg |
14171689 |
T |
|
| Q |
116 |
aaccttgaagaccaaatttaagaatttgaaaaacttcttggggaacctcttcaaagtaggctgagtctgatgtctgtcttgacacatatttcttcagctt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14171688 |
aaccttgaagaccaaatttaagaatttgaaaaacttcttggggaacctcttcaaagtaggctgagtctgatgtctgtcttgacacatatttcttcagctt |
14171589 |
T |
|
| Q |
216 |
tacttcctccagattcctaactacttttgagaaccagctcttgagggcttcttttttggcagtaattgagatattcttc |
294 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14171588 |
tacttcctccagattcctgactacttttgagaaccagctcttgagggcttcttttttggcagtaattgagatattcttc |
14171510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University