View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18566_low_10 (Length: 341)
Name: NF18566_low_10
Description: NF18566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18566_low_10 |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0007 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 24 - 329
Target Start/End: Complemental strand, 150514 - 150209
Alignment:
| Q |
24 |
tgagaagatctcattcttgatcccataaactgtgaaagttcttcaaaaacttcttcatcaaaagaagctggtaacctatgcaactttctttcataaggtg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
150514 |
tgagaagatctcattcttgatcccataaactgtgaaagttcttcaaaaacttcttcatcaaaagaagctggtaacctatgcaactttctttcataaggtg |
150415 |
T |
 |
| Q |
124 |
acagtctaaaatagcttttaccaacttgttctctttcaccacctctttcccattcataaactttcctaaactcacctaacatgttatcccattttgtacc |
223 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
150414 |
aaagtctaaaatagcttttaccaacttgttctctttcaccacctctttcccattcataaactttcctaaactcacctaacatgttatcccattttgtacc |
150315 |
T |
 |
| Q |
224 |
tgctgtttttgcatctctattaacaccatgtttgtttagaaattcagctacttctttgtctttatcagctcttgtttttcctctactcattcccatctct |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
150314 |
tgctgtttttgcatctctattaacaccatgtttgtttagaaattcagctacttctttgtctttatcagctcttgttttccctctactcattcccatctct |
150215 |
T |
 |
| Q |
324 |
tgttca |
329 |
Q |
| |
|
|||||| |
|
|
| T |
150214 |
tgttca |
150209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University