View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18566_low_14 (Length: 299)
Name: NF18566_low_14
Description: NF18566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18566_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 6 - 285
Target Start/End: Complemental strand, 46795898 - 46795622
Alignment:
| Q |
6 |
aggagcagagaagctaccactgtgttgaattgtgatcttttccacacaatacctagggttttcaaccattggttccaaatgttctctttccctaataatt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46795898 |
aggagcagagaagctaccactgtgttgaattgtgatcttttccacacaatacctagggttttcaaccattggttccaaatgttctctttccctaataatt |
46795799 |
T |
 |
| Q |
106 |
tcccttcttcatcatcttcttcttcttaccctaatagtaccctttcttttctcattgacaatcctgaaaataatgattttccaaataacaatactactct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46795798 |
tcccttcttcatcatcttcttcttcttaccctaatagtaccctttcttttctcattgacaatcctgaaaataatgattttccaaataacaatactactct |
46795699 |
T |
 |
| Q |
206 |
tcttgatgattcactactttctattcctttcactacatcaacacatcatgatgttgttccattccctgatgctaattttg |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46795698 |
tcttgatgattcactactttctattcctttc---acatcaacacatcatgatgttgttccattccctgatactaattttg |
46795622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University