View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18566_low_15 (Length: 295)

Name: NF18566_low_15
Description: NF18566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18566_low_15
NF18566_low_15
[»] chr1 (1 HSPs)
chr1 (3-293)||(21078307-21078597)
[»] chr6 (1 HSPs)
chr6 (215-271)||(3073724-3073780)
[»] chr4 (1 HSPs)
chr4 (215-271)||(27732088-27732144)


Alignment Details
Target: chr1 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 3 - 293
Target Start/End: Original strand, 21078307 - 21078597
Alignment:
3 atgataaggtttttccttccaacatgagatcgcaccgcgaaaagggtattgagtctccaaccacatccttcttccctgtctccttcttggagcaacagag 102  Q
    |||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
21078307 atgataaggtttttccgtccaacatgagatcgcactgcgaaaagggtattgagtctccgaccacatccttcttccctgtctccttcttggagcaacagag 21078406  T
103 tgatatgtgtgatcttgatcagtttcaagtggatgatgcaccaccagttattaacttatccaaatattttcctccaagttcccataaaaagaaaaagcgc 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||    
21078407 tgatatgtgtgatcttgatcagtttcaagtggatgatgcaccaccagttattaacttatccaaatatttgcctccaagttcccataaaaagaaaaaacgc 21078506  T
203 agcatcgtgagaagaaatatgattgatcatgaacttcttaatgcagcacatatactcttggatatgtctcgtggtggtggtggtgatgatg 293  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21078507 agcatcgtgagaagaaatatgattgatcatgaacttcttaatgcagcacatatactcttggatatgtctcgtggtggtggtggtgatgatg 21078597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 215 - 271
Target Start/End: Complemental strand, 3073780 - 3073724
Alignment:
215 agaaatatgattgatcatgaacttcttaatgcagcacatatactcttggatatgtct 271  Q
    |||||||| ||||||||||||| |||||||| |||| ||| |||||| |||||||||    
3073780 agaaatatcattgatcatgaacatcttaatggagcatatacactcttcgatatgtct 3073724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 215 - 271
Target Start/End: Complemental strand, 27732144 - 27732088
Alignment:
215 agaaatatgattgatcatgaacttcttaatgcagcacatatactcttggatatgtct 271  Q
    |||||||| ||||||||||||| |||||||| |||||| | ||||||  ||||||||    
27732144 agaaatatcattgatcatgaacatcttaatggagcacaaacactcttcaatatgtct 27732088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University