View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18567_high_13 (Length: 301)
Name: NF18567_high_13
Description: NF18567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18567_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 7 - 251
Target Start/End: Original strand, 23324169 - 23324413
Alignment:
| Q |
7 |
gaaatgaacttgtcttggaaatggattggacttaggttgttcattagtttttgcagctgatttttagcttcatctctttcttggtacgctgttttaagta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
23324169 |
gaaatgaacttgtcttggaaatggattggacttgggttgttcattagtttttgcagctgatttttagcttcatctctttctaggtacgctgttttaagta |
23324268 |
T |
 |
| Q |
107 |
gattgaacagttctgtcttcatgtttttcattgcttcaagttcaagtgttgtgtctatgagtttttgtcttagttcatgttccctctgcaaaatcaaaca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23324269 |
gattgaacagttctgtcttcatgtttttcattgcttcaagttcaagtgttgtgtctatgagtttttgtcttagttcatgttccctctgcaaaatcaaaca |
23324368 |
T |
 |
| Q |
207 |
aggaaaattttagtttgttttgaaggggaaaaaattatgattatt |
251 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||| ||||||||||| |
|
|
| T |
23324369 |
aggaaaattttagttggttttgaagggaaaaaagttatgattatt |
23324413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University