View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18567_high_14 (Length: 251)
Name: NF18567_high_14
Description: NF18567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18567_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 13 - 235
Target Start/End: Original strand, 18297617 - 18297839
Alignment:
| Q |
13 |
aaaatgcgcctccataaaccactggtagggcggtgtaacaaacttcaatcctcacctcatgaaaaaagaatgaaacttagacatacaatagtgatttgca |
112 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18297617 |
aaaatgcgcctccataaaccaccggtaaggcggtgtaacaggcttcaatcctcacctcatgaaaaaagattgaaacttagacatacaatagtgatttgca |
18297716 |
T |
 |
| Q |
113 |
ctcatcatgataaccaaccgcggcaaagccgacggtttaatgagaagaggtggtgatgccgagggcgagttcaccacccatgtgctgctacaatggatca |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18297717 |
ctcatcatgataaccaaccgcggcaaagccgggggtttaatgagaagaggtggtgataccgagggcgagttcaccacccatgtgctgctacaatggatca |
18297816 |
T |
 |
| Q |
213 |
aaatgatttggatgtgttgaaat |
235 |
Q |
| |
|
||| ||||||||||||||||||| |
|
|
| T |
18297817 |
aaacgatttggatgtgttgaaat |
18297839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University