View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18567_high_17 (Length: 216)

Name: NF18567_high_17
Description: NF18567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18567_high_17
NF18567_high_17
[»] chr3 (1 HSPs)
chr3 (16-199)||(48652850-48653032)


Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 16 - 199
Target Start/End: Original strand, 48652850 - 48653032
Alignment:
16 aatattagggtatccccgattctaatttttatgtttactagtatttgctttttggatagactttatattgatttgtagagcgacttttacggtagagaaa 115  Q
    |||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48652850 aatattagggtatccc-gattctaattttcatgtttactagtatttgctttttggatagactttatattgatttgtagagcgacttttacggtagagaaa 48652948  T
116 tatcttatataatatatgtggaccagtttttgaattgattgatatagtttctcttaattagaagttcataatattattattatc 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48652949 tatcttatataatatatgtggaccagtttttgaattgattgatatagtttctcttaattagaagttcataatattattattatc 48653032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University