View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18567_low_18 (Length: 225)
Name: NF18567_low_18
Description: NF18567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18567_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 125 - 211
Target Start/End: Original strand, 10599742 - 10599830
Alignment:
| Q |
125 |
agattcaacatcatcagctgacaaatgaaattgttagcat--aagacatatatataacacatgtcatgttggaaagagagtagaataat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10599742 |
agattcaacatcatcagctgacaaatgaaattgttagcataaaacacatatatataacacatgtcacgttggaaagagagtagaataat |
10599830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 20 - 128
Target Start/End: Original strand, 10599606 - 10599710
Alignment:
| Q |
20 |
gttttcttttccaacgtcagctcacaaaattgcttgttctcgagcatctnnnnnnnnntgacattaccggttagtgtttgtttataaattaataaccatg |
119 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
10599606 |
gttttcttttccaacgtcagctcacgaaattgcttgttctcgagcatctaaaaaaaaaagacattaacggttag----tgtttataaattaataaccatg |
10599701 |
T |
|
| Q |
120 |
atataagat |
128 |
Q |
| |
|
||||||||| |
|
|
| T |
10599702 |
atataagat |
10599710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 27 - 68
Target Start/End: Complemental strand, 6254650 - 6254609
Alignment:
| Q |
27 |
tttccaacgtcagctcacaaaattgcttgttctcgagcatct |
68 |
Q |
| |
|
|||||||| ||||||||||||||||||||| || |||||||| |
|
|
| T |
6254650 |
tttccaacatcagctcacaaaattgcttgtcctggagcatct |
6254609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University