View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18567_low_19 (Length: 216)
Name: NF18567_low_19
Description: NF18567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18567_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 16 - 199
Target Start/End: Original strand, 48652850 - 48653032
Alignment:
| Q |
16 |
aatattagggtatccccgattctaatttttatgtttactagtatttgctttttggatagactttatattgatttgtagagcgacttttacggtagagaaa |
115 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48652850 |
aatattagggtatccc-gattctaattttcatgtttactagtatttgctttttggatagactttatattgatttgtagagcgacttttacggtagagaaa |
48652948 |
T |
|
| Q |
116 |
tatcttatataatatatgtggaccagtttttgaattgattgatatagtttctcttaattagaagttcataatattattattatc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48652949 |
tatcttatataatatatgtggaccagtttttgaattgattgatatagtttctcttaattagaagttcataatattattattatc |
48653032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University