View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18568_high_10 (Length: 235)
Name: NF18568_high_10
Description: NF18568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18568_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 3e-66; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 46660714 - 46660571
Alignment:
| Q |
1 |
cttcacatgggacatctgagaaagttttgcagacttatgctgggatgttgatgcctaacacagagcaaccttttcgccttaactgggcgacatttagcgc |
100 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
46660714 |
cttcacatgggacagctgagaaagtcttgcagacttatgctgggatgttgatgcctaacacagagcaaccttttcgccttaactgggcgacatttagcac |
46660615 |
T |
 |
| Q |
101 |
aggagatcacaaacgctcagataatgtccctgatctttctattt |
144 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46660614 |
aggagatcacaaacgttcagataatgtccctgatctttctattt |
46660571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 147 - 185
Target Start/End: Complemental strand, 46660535 - 46660497
Alignment:
| Q |
147 |
atgttacttgaaactttttctgataaatacccttcagtt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46660535 |
atgttacttgaaactttttctgataaatacccttcagtt |
46660497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 217
Target Start/End: Complemental strand, 46660478 - 46660445
Alignment:
| Q |
184 |
tttgatgccaataccgaacgttcaaagggttatg |
217 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
46660478 |
tttgatgccaataccggacgttcaaagggttatg |
46660445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 106
Target Start/End: Original strand, 6173850 - 6173954
Alignment:
| Q |
2 |
ttcacatgggacatctgagaaagttttgcagacttatgctgggatgttgatgcctaacacagagcaaccttttcgccttaactgggcgacatttagcgca |
101 |
Q |
| |
|
|||||||| ||| ||||||||||||| |||| ||||||||| || |||||||| || | || ||| |||| || | |||||||| ||||||||| || |
|
|
| T |
6173850 |
ttcacatgccacagctgagaaagttttacagaattatgctggaattttgatgccaaatgctgatcaagctttccgtttgaactgggcaacatttagcaca |
6173949 |
T |
 |
| Q |
102 |
ggaga |
106 |
Q |
| |
|
||||| |
|
|
| T |
6173950 |
ggaga |
6173954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University