View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18568_high_6 (Length: 284)
Name: NF18568_high_6
Description: NF18568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18568_high_6 |
 | |
|
| [»] scaffold0001 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 20051496 - 20051264
Alignment:
| Q |
1 |
aaaatgatgggagcaagtaaaataattggggttgataaaaatgagatgaagagagaaaaaggagaagctttcggaatgacccactttataaatccgagtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20051496 |
aaaatgatgggagcaagtaaaataattggggttgataaaaatgagatgaagagagaaaaaggagaagctttcggaatgacccactttataaatccaagtg |
20051397 |
T |
|
| Q |
101 |
gttcatataagtctgcttctgatttggttaaagaactaagtggtggaatgggtgtcgattattccttcgagtgcactggagttccttctttacttaatgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20051396 |
gttcatataagtctgcttctgatttggttaaagaactaagtggtggaatgggtgtcgattattccttcgagtgcactggagttccttctttacttaatgt |
20051297 |
T |
|
| Q |
201 |
atccgttgaagccacgaaattagtaagttcaac |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
20051296 |
atccgttgaagccacgaaattagtaagttcaac |
20051264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 235 - 284
Target Start/End: Complemental strand, 20051233 - 20051184
Alignment:
| Q |
235 |
tgagtcgaataaatcttgatcacatggttaatttttctgatatgttatgc |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
20051233 |
tgagtcgaataaatcttgatcacatggttaatttgtgtgatatgttatgc |
20051184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 4 - 134
Target Start/End: Complemental strand, 505511 - 505381
Alignment:
| Q |
4 |
atgatgggagcaagtaaaataattggggttgataaaaatgagatgaagagagaaaaaggagaagctttcggaatgacccactttataaatccgagtggtt |
103 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||| || |||||||| ||||||||| | | || || |
|
|
| T |
505511 |
atgatgggagcaagtaagataattggggttgacaaaaacgagatgaagagagaaaaaggagaagcttttgggatgacccattttataaattctaatgatt |
505412 |
T |
|
| Q |
104 |
catataagtctgcttctgatttggttaaaga |
134 |
Q |
| |
|
| |||| |||||||| || ||||||||||| |
|
|
| T |
505411 |
ctgataaatctgcttcagaattggttaaaga |
505381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University