View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18568_low_11 (Length: 235)

Name: NF18568_low_11
Description: NF18568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18568_low_11
NF18568_low_11
[»] chr3 (3 HSPs)
chr3 (1-144)||(46660571-46660714)
chr3 (147-185)||(46660497-46660535)
chr3 (184-217)||(46660445-46660478)
[»] chr1 (1 HSPs)
chr1 (2-106)||(6173850-6173954)


Alignment Details
Target: chr3 (Bit Score: 128; Significance: 3e-66; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 46660714 - 46660571
Alignment:
1 cttcacatgggacatctgagaaagttttgcagacttatgctgggatgttgatgcctaacacagagcaaccttttcgccttaactgggcgacatttagcgc 100  Q
    |||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
46660714 cttcacatgggacagctgagaaagtcttgcagacttatgctgggatgttgatgcctaacacagagcaaccttttcgccttaactgggcgacatttagcac 46660615  T
101 aggagatcacaaacgctcagataatgtccctgatctttctattt 144  Q
    ||||||||||||||| ||||||||||||||||||||||||||||    
46660614 aggagatcacaaacgttcagataatgtccctgatctttctattt 46660571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 147 - 185
Target Start/End: Complemental strand, 46660535 - 46660497
Alignment:
147 atgttacttgaaactttttctgataaatacccttcagtt 185  Q
    |||||||||||||||||||||||||||||||||||||||    
46660535 atgttacttgaaactttttctgataaatacccttcagtt 46660497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 217
Target Start/End: Complemental strand, 46660478 - 46660445
Alignment:
184 tttgatgccaataccgaacgttcaaagggttatg 217  Q
    |||||||||||||||| |||||||||||||||||    
46660478 tttgatgccaataccggacgttcaaagggttatg 46660445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 106
Target Start/End: Original strand, 6173850 - 6173954
Alignment:
2 ttcacatgggacatctgagaaagttttgcagacttatgctgggatgttgatgcctaacacagagcaaccttttcgccttaactgggcgacatttagcgca 101  Q
    ||||||||  ||| ||||||||||||| |||| ||||||||| || |||||||| ||  | || ||| |||| ||  | |||||||| ||||||||| ||    
6173850 ttcacatgccacagctgagaaagttttacagaattatgctggaattttgatgccaaatgctgatcaagctttccgtttgaactgggcaacatttagcaca 6173949  T
102 ggaga 106  Q
    |||||    
6173950 ggaga 6173954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University