View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18568_low_12 (Length: 233)
Name: NF18568_low_12
Description: NF18568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18568_low_12 |
 |  |
|
| [»] scaffold0856 (2 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0856 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: scaffold0856
Description:
Target: scaffold0856; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 36 - 233
Target Start/End: Complemental strand, 3710 - 3513
Alignment:
| Q |
36 |
caaccacgaagtttagtcagctaaggaacaagctaggagtagtcaaaccatcctctagcttgagaggggcagttaaggaatgatcatagccagtttgaaa |
135 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3710 |
caaccatgaagtttagtcagctaaggaacaagctaggagtagtcaaaccatcctctagcttgagaggggcagttaaggaatgatcatagccagtttgaaa |
3611 |
T |
 |
| Q |
136 |
ttgtctccgaccgatagcatgatatcttgatttaaatttgtagattttctaaatctcttatctttcatctgtaattcggaattgtgttatcttatcct |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3610 |
ttgtctccgaccgatagcatgatatcttgatttaaatttgtagattttctaaatctcttatctttcatctgtaattcggaattgtgttatcttatcct |
3513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0856; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 3787 - 3748
Alignment:
| Q |
1 |
gttgttgagtaataacgtgactatagcctatggtccaacc |
40 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3787 |
gttgttgagtaataacgcgactatagcctatggtccaacc |
3748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University