View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18569_high_17 (Length: 222)
Name: NF18569_high_17
Description: NF18569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18569_high_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 40515455 - 40515647
Alignment:
| Q |
1 |
tgttttttgtccggcagataagtaggggccatattagccatacatacccatactgccaaacagaatacagatatagagagggccgaggggagttagttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40515455 |
tgttttttgtccggcagataagtaggggccatattagccatacatacccatactgccaaacagaatacagatatagagagggccgaggggagttagttta |
40515554 |
T |
|
| Q |
101 |
gttttcatttcatttcatttccatcccattcaattaaaccaaactggtcggttggagagagtgaaagaaggaatggctatggttacttactactacta |
198 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40515555 |
gt-----tttcatttcatttccatcccattcaattaaaccaaactggtcggttggagagagtgaaagaaggaatggctatggttacttactactacta |
40515647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University