View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18569_low_12 (Length: 294)
Name: NF18569_low_12
Description: NF18569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18569_low_12 |
 |  |
|
| [»] chr7 (44 HSPs) |
 |  |
|
| [»] chr4 (51 HSPs) |
 |  |
|
| [»] chr8 (43 HSPs) |
 |  |
|
| [»] chr6 (30 HSPs) |
 |  |
|
| [»] chr2 (39 HSPs) |
 |  |
|
| [»] chr1 (46 HSPs) |
 |  |
|
| [»] chr3 (54 HSPs) |
 |  |
|
| [»] scaffold0347 (1 HSPs) |
 |  |
|
| [»] scaffold0105 (1 HSPs) |
 |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |
|
| [»] scaffold0535 (2 HSPs) |
 |  |
|
| [»] scaffold0210 (2 HSPs) |
 |  |
|
| [»] scaffold0051 (2 HSPs) |
 |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |
|
| [»] scaffold0339 (1 HSPs) |
 |  |  |
|
| [»] scaffold0337 (1 HSPs) |
 |  |  |
|
| [»] scaffold0065 (2 HSPs) |
 |  |  |
|
| [»] scaffold0811 (1 HSPs) |
 |  |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |  |
|
| [»] scaffold0326 (2 HSPs) |
 |  |  |
|
| [»] scaffold0060 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 50)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 28 - 251
Target Start/End: Original strand, 42026783 - 42027007
Alignment:
| Q |
28 |
catgtatggagtaaaataaataatcgtgtatggaattaatacatatacaactttcaaactgtaatctgcgacttcaattcctattgaaaaagaatctgca |
127 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
42026783 |
catgtatggaataaaataaataatcgtgtatggaattaatacatatacaactttcaaactgtaatctgcaacttcaatttctattgaaaaagaatctgca |
42026882 |
T |
 |
| Q |
128 |
acatcaattgtttgtgattgttcataatgaagat-nnnnnnntggtaacctaaaaattgtgaccacagttttaaaacttggatatacatgaatccttcca |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42026883 |
acatcaattgtttgtgattgttcataatgaagataaaaaaaatggtaacctaaaaattgtgaccacagttttaaaacttggatatacatgaatccttcca |
42026982 |
T |
 |
| Q |
227 |
atcaaaatatcttacgttatgtaat |
251 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
42026983 |
atcaaaatatcttacgttatgtaat |
42027007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 34125307 - 34125341
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
34125307 |
ggctaaaatatagttttagtccctgcaaatatgcc |
34125341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 6118500 - 6118465
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6118500 |
tggctaaaatatggttttagtccctgcaaatatgcc |
6118465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 18633962 - 18633927
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18633962 |
tggctaaaatatggttttagtccctgcaaatatgcc |
18633927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 28550826 - 28550861
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28550826 |
tggctaaaatatggttttagtccctgcaaatatgcc |
28550861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 28863839 - 28863804
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28863839 |
tggctaaaatatggttttagtccctgcaaatatgcc |
28863804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 40029498 - 40029463
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40029498 |
tggctaaaatatggttttagtccctgcaaatatgcc |
40029463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 293828 - 293862
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
293828 |
ggctaaaatatggttttagtccctgcaaatatgcc |
293862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 2217494 - 2217528
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2217494 |
ggctaaaatatggttttagtccctgcaaatatgcc |
2217528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 2217854 - 2217820
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2217854 |
ggctaaaatatggttttagtccctgcaaatatgcc |
2217820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 4203456 - 4203490
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4203456 |
ggctaaaatatggttttagtccctgcaaatatgcc |
4203490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 5614530 - 5614496
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5614530 |
ggctaaaatatggttttagtccctgcaaatatgcc |
5614496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 5950176 - 5950210
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5950176 |
ggctaaaatatggttttagtccctgcaaatatgcc |
5950210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 7075572 - 7075606
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7075572 |
ggctaaaatatggttttagtccctgcaaatatgcc |
7075606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 10408928 - 10408962
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10408928 |
ggctaaaatatggttttagtccctgcaaatatgcc |
10408962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 10409326 - 10409292
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10409326 |
ggctaaaatatggttttagtccctgcaaatatgcc |
10409292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 10743724 - 10743758
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10743724 |
ggctaaaatatggttttagtccctgcaaatatgcc |
10743758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 16038377 - 16038411
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16038377 |
ggctaaaatatggttttagtccctgcaaatatgcc |
16038411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 18046348 - 18046314
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18046348 |
ggctaaaatatggttttagtccctgcaaatatgcc |
18046314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 18633599 - 18633633
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18633599 |
ggctaaaatatggttttagtccctgcaaatatgcc |
18633633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 259 - 293
Target Start/End: Complemental strand, 21050914 - 21050880
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
21050914 |
tggctaaaatatggttttagtccctgcaaatatgc |
21050880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 23382297 - 23382263
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23382297 |
ggctaaaatatggttttagtccctgcaaatatgcc |
23382263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 259 - 293
Target Start/End: Original strand, 25561704 - 25561738
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
25561704 |
tggctaaaatatggttttagtccctgcaaatatgc |
25561738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 25561999 - 25561965
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25561999 |
ggctaaaatatggttttagtccctgcaaatatgcc |
25561965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 28863510 - 28863544
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28863510 |
ggctaaaatatggttttagtccctgcaaatatgcc |
28863544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 29172886 - 29172852
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29172886 |
ggctaaaatatggttttagtccctgcaaatatgcc |
29172852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 29692744 - 29692778
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29692744 |
ggctaaaatatggttttagtccctgcaaatatgcc |
29692778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 29875725 - 29875691
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29875725 |
ggctaaaatatggttttagtccctgcaaatatgcc |
29875691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 30800494 - 30800528
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30800494 |
ggctaaaatatggttttagtccctgcaaatatgcc |
30800528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 30800850 - 30800816
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30800850 |
ggctaaaatatggttttagtccctgcaaatatgcc |
30800816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 35166911 - 35166945
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35166911 |
ggctaaaatatggttttagtccctgcaaatatgcc |
35166945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 35167165 - 35167131
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35167165 |
ggctaaaatatggttttagtccctgcaaatatgcc |
35167131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 36578083 - 36578049
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36578083 |
ggctaaaatatggttttagtccctgcaaatatgcc |
36578049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 293
Target Start/End: Original strand, 11799129 - 11799162
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
11799129 |
ggctaaaatatggttttagtccctgcaaatatgc |
11799162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 293
Target Start/End: Complemental strand, 25779162 - 25779129
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
25779162 |
ggctaaaatatggttttagtccctgcaaatatgc |
25779129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 294
Target Start/End: Original strand, 29172524 - 29172557
Alignment:
| Q |
261 |
gctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
29172524 |
gctaaaatatggttttagtccctgcaaatatgcc |
29172557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 292
Target Start/End: Complemental strand, 29366950 - 29366917
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
29366950 |
tggctaaaatatggttttagtccctgcaaatatg |
29366917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 292
Target Start/End: Complemental strand, 33336027 - 33335994
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
33336027 |
tggctaaaatatggttttagtccctgcaaatatg |
33335994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 293
Target Start/End: Original strand, 38786159 - 38786192
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
38786159 |
ggctaaaatatggttttagtccctgcaaatatgc |
38786192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 293
Target Start/End: Complemental strand, 39379610 - 39379577
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
39379610 |
ggctaaaatatggttttagtccctgcaaatatgc |
39379577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 292
Target Start/End: Original strand, 42994067 - 42994100
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
42994067 |
tggctaaaatatggttttagtccctgcaaatatg |
42994100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 4203770 - 4203738
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
4203770 |
ggctaaaatatggttttagtccctgcaaatatg |
4203738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 5614166 - 5614198
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
5614166 |
ggctaaaatatggttttagtccctgcaaatatg |
5614198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 262 - 294
Target Start/End: Original strand, 16616370 - 16616402
Alignment:
| Q |
262 |
ctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
16616370 |
ctaaaatatggttttagtccctgcaaatatgcc |
16616402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 18046038 - 18046070
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
18046038 |
ggctaaaatatggttttagtccctgcaaatatg |
18046070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 23381950 - 23381982
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
23381950 |
ggctaaaatatggttttagtccctgcaaatatg |
23381982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 26133413 - 26133381
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
26133413 |
ggctaaaatatggttttagtccctgcaaatatg |
26133381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 31037741 - 31037709
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
31037741 |
ggctaaaatatggttttagtccctgcaaatatg |
31037709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 36577722 - 36577754
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
36577722 |
ggctaaaatatggttttagtccctgcaaatatg |
36577754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 38496782 - 38496750
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
38496782 |
ggctaaaatatggttttagtccctgcaaatatg |
38496750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 44)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 30352905 - 30352870
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
30352905 |
tggctaaaatatagttttagtccctgcaaatatgcc |
30352870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 1559343 - 1559377
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
1559343 |
ggctaaaatatagttttagtccctgcaaatatgcc |
1559377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 45073641 - 45073607
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
45073641 |
ggctaaaatatagttttagtccctgcaaatatgcc |
45073607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 259 - 292
Target Start/End: Complemental strand, 18927092 - 18927059
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
18927092 |
tggctaaaatatagttttagtccctgcaaatatg |
18927059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 259 - 292
Target Start/End: Complemental strand, 46304385 - 46304352
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
46304385 |
tggctaaaatatagttttagtccctgcaaatatg |
46304352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 19783815 - 19783847
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
19783815 |
ggctaaaatatagttttagtccctgcaaatatg |
19783847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 1006834 - 1006869
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1006834 |
tggctaaaatatggttttagtccctgcaaatatgcc |
1006869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 7431950 - 7431985
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7431950 |
tggctaaaatatggttttagtccctgcaaatatgcc |
7431985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 19561153 - 19561188
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19561153 |
tggctaaaatatggttttagtccctgcaaatatgcc |
19561188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 31732100 - 31732135
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31732100 |
tggctaaaatatggttttagtccctgcaaatatgcc |
31732135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 44508719 - 44508754
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44508719 |
tggctaaaatatggttttagtccctgcaaatatgcc |
44508754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 45021493 - 45021528
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45021493 |
tggctaaaatatggttttagtccctgcaaatatgcc |
45021528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 1559705 - 1559671
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1559705 |
ggctaaaatatggttttagtccctgcaaatatgcc |
1559671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 6108334 - 6108368
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6108334 |
ggctaaaatatggttttagtccctgcaaatatgcc |
6108368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 6509208 - 6509242
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6509208 |
ggctaaaatatggttttagtccctgcaaatatgcc |
6509242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 8555799 - 8555765
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8555799 |
ggctaaaatatggttttagtccctgcaaatatgcc |
8555765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 12894402 - 12894368
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12894402 |
ggctaaaatatggttttagtccctgcaaatatgcc |
12894368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 13770081 - 13770047
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13770081 |
ggctaaaatatggttttagtccctgcaaatatgcc |
13770047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 17999465 - 17999499
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17999465 |
ggctaaaatatggttttagtccctgcaaatatgcc |
17999499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 17999721 - 17999687
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17999721 |
ggctaaaatatggttttagtccctgcaaatatgcc |
17999687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 19757748 - 19757782
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19757748 |
ggctaaaatatggttttagtccctgcaaatatgcc |
19757782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 20388274 - 20388308
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20388274 |
ggctaaaatatggttttagtccctgcaaatatgcc |
20388308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 21554753 - 21554719
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21554753 |
ggctaaaatatggttttagtccctgcaaatatgcc |
21554719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 28911577 - 28911611
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28911577 |
ggctaaaatatggttttagtccctgcaaatatgcc |
28911611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 28911906 - 28911872
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28911906 |
ggctaaaatatggttttagtccctgcaaatatgcc |
28911872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 35015220 - 35015186
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35015220 |
ggctaaaatatggttttagtccctgcaaatatgcc |
35015186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 37372904 - 37372870
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37372904 |
ggctaaaatatggttttagtccctgcaaatatgcc |
37372870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 262 - 292
Target Start/End: Original strand, 43058752 - 43058782
Alignment:
| Q |
262 |
ctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
43058752 |
ctaaaatatagttttagtccctgcaaatatg |
43058782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 44402960 - 44402994
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44402960 |
ggctaaaatatggttttagtccctgcaaatatgcc |
44402994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 44509054 - 44509020
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44509054 |
ggctaaaatatggttttagtccctgcaaatatgcc |
44509020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 45021856 - 45021822
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45021856 |
ggctaaaatatggttttagtccctgcaaatatgcc |
45021822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 292
Target Start/End: Original strand, 1974008 - 1974041
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
1974008 |
tggctaaaatatggttttagtccctgcaaatatg |
1974041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 294
Target Start/End: Original strand, 6079810 - 6079843
Alignment:
| Q |
261 |
gctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
6079810 |
gctaaaatatggttttagtccctgcaaatatgcc |
6079843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 292
Target Start/End: Original strand, 13769773 - 13769806
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
13769773 |
tggctaaaatatggttttagtccctgcaaatatg |
13769806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 293
Target Start/End: Complemental strand, 14739004 - 14738971
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
14739004 |
ggctaaaatatggttttagtccctgcaaatatgc |
14738971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 292
Target Start/End: Complemental strand, 25547491 - 25547458
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
25547491 |
tggctaaaatatggttttagtccctgcaaatatg |
25547458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 293
Target Start/End: Complemental strand, 31310679 - 31310646
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
31310679 |
ggctaaaatatggttttagtccctgcaaatatgc |
31310646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 292
Target Start/End: Complemental strand, 48359076 - 48359043
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
48359076 |
tggctaaaatatggttttagtccctgcaaatatg |
48359043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 19561450 - 19561418
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
19561450 |
ggctaaaatatggttttagtccctgcaaatatg |
19561418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 23816670 - 23816702
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
23816670 |
ggctaaaatatggttttagtccctgcaaatatg |
23816702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 35210515 - 35210483
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
35210515 |
ggctaaaatatggttttagtccctgcaaatatg |
35210483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 39719642 - 39719610
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
39719642 |
ggctaaaatatggttttagtccctgcaaatatg |
39719610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 39832906 - 39832938
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
39832906 |
ggctaaaatatggttttagtccctgcaaatatg |
39832938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 44344789 - 44344757
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
44344789 |
ggctaaaatatggttttagtccctgcaaatatg |
44344757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 51)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 27008083 - 27008118
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
27008083 |
tggctaaaatatagttttagtccctgcaaatatgcc |
27008118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 259 - 292
Target Start/End: Complemental strand, 2180573 - 2180540
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2180573 |
tggctaaaatatagttttagtccctgcaaatatg |
2180540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 29380668 - 29380700
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
29380668 |
ggctaaaatatagttttagtccctgcaaatatg |
29380700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 8191392 - 8191357
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8191392 |
tggctaaaatatggttttagtccctgcaaatatgcc |
8191357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 261 - 292
Target Start/End: Original strand, 12791610 - 12791641
Alignment:
| Q |
261 |
gctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12791610 |
gctaaaatatagttttagtccctgcaaatatg |
12791641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 261 - 292
Target Start/End: Complemental strand, 15555637 - 15555606
Alignment:
| Q |
261 |
gctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
15555637 |
gctaaaatatagttttagtccctgcaaatatg |
15555606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 22099542 - 22099577
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22099542 |
tggctaaaatatggttttagtccctgcaaatatgcc |
22099577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 35415634 - 35415599
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35415634 |
tggctaaaatatggttttagtccctgcaaatatgcc |
35415599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 50714239 - 50714274
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
50714239 |
tggctaaaatatggttttagtccctgcaaatatgcc |
50714274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 53717175 - 53717140
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53717175 |
tggctaaaatatggttttagtccctgcaaatatgcc |
53717140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 123534 - 123568
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
123534 |
ggctaaaatatggttttagtccctgcaaatatgcc |
123568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 2180220 - 2180254
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2180220 |
ggctaaaatatggttttagtccctgcaaatatgcc |
2180254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 8904886 - 8904920
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8904886 |
ggctaaaatatagttttggtccctgcaaatatgcc |
8904920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 13064159 - 13064193
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13064159 |
ggctaaaatatggttttagtccctgcaaatatgcc |
13064193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 13064465 - 13064431
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13064465 |
ggctaaaatatggttttagtccctgcaaatatgcc |
13064431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 16712691 - 16712657
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16712691 |
ggctaaaatatggttttagtccctgcaaatatgcc |
16712657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 18205156 - 18205190
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18205156 |
ggctaaaatatggttttagtccctgcaaatatgcc |
18205190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 23778964 - 23778998
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23778964 |
ggctaaaatatggttttagtccctgcaaatatgcc |
23778998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 29463913 - 29463879
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29463913 |
ggctaaaatatggttttagtccctgcaaatatgcc |
29463879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 32208542 - 32208576
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32208542 |
ggctaaaatatggttttagtccctgcaaatatgcc |
32208576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 32365094 - 32365128
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32365094 |
ggctaaaatatggttttagtccctgcaaatatgcc |
32365128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 35763647 - 35763681
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35763647 |
ggctaaaatatggttttagtccctgcaaatatgcc |
35763681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 41345853 - 41345887
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41345853 |
ggctaaaatatggttttagtccctgcaaatatgcc |
41345887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 45505600 - 45505634
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45505600 |
ggctaaaatatggttttagtccctgcaaatatgcc |
45505634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 45505894 - 45505860
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45505894 |
ggctaaaatatggttttagtccctgcaaatatgcc |
45505860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 45593228 - 45593262
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
45593228 |
ggctaaaatatagttttagtccctacaaatatgcc |
45593262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 46292651 - 46292617
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46292651 |
ggctaaaatatggttttagtccctgcaaatatgcc |
46292617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 51709027 - 51708993
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51709027 |
ggctaaaatatggttttagtccctgcaaatatgcc |
51708993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 52017505 - 52017539
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52017505 |
ggctaaaatatggttttagtccctgcaaatatgcc |
52017539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 52017870 - 52017836
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52017870 |
ggctaaaatatggttttagtccctgcaaatatgcc |
52017836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 293
Target Start/End: Complemental strand, 28809180 - 28809147
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
28809180 |
ggctaaaatatggttttagtccctgcaaatatgc |
28809147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 293
Target Start/End: Complemental strand, 45474596 - 45474563
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
45474596 |
ggctaaaatatggttttagtccctgcaaatatgc |
45474563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 292
Target Start/End: Complemental strand, 47274231 - 47274198
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
47274231 |
tggctaaaatatagttttagttcctgcaaatatg |
47274198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 292
Target Start/End: Complemental strand, 50714566 - 50714533
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
50714566 |
tggctaaaatatggttttagtccctgcaaatatg |
50714533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 294
Target Start/End: Complemental strand, 51763201 - 51763168
Alignment:
| Q |
261 |
gctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
51763201 |
gctaaaatatagttttggtccctgcaaatatgcc |
51763168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 293
Target Start/End: Original strand, 55072389 - 55072422
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
55072389 |
ggctaaaatatggttttagtccctgcaaatatgc |
55072422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 8760604 - 8760636
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
8760604 |
ggctaaaatatagttttactccctgcaaatatg |
8760636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 9289266 - 9289298
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
9289266 |
ggctaaaatatggttttagtccctgcaaatatg |
9289298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 13479611 - 13479579
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
13479611 |
ggctaaaatatggttttagtccctgcaaatatg |
13479579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 22099912 - 22099880
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
22099912 |
ggctaaaatatggttttagtccctgcaaatatg |
22099880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 24474963 - 24474931
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
24474963 |
ggctaaaatatggttttagtccctgcaaatatg |
24474931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 29380910 - 29380878
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
29380910 |
ggctaaaatatggttttagtccctgcaaatatg |
29380878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 32365483 - 32365451
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
32365483 |
ggctaaaatatggttttagtccctgcaaatatg |
32365451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 34361803 - 34361835
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
34361803 |
ggctaaaatatggttttagtccctgcaaatatg |
34361835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 36702000 - 36702032
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
36702000 |
ggctaaaatatggttttagtccctgcaaatatg |
36702032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 41346218 - 41346186
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
41346218 |
ggctaaaatatggttttagtccctgcaaatatg |
41346186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 46088060 - 46088028
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
46088060 |
ggctaaaatatggttttagtccctgcaaatatg |
46088028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 51708693 - 51708725
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
51708693 |
ggctaaaatatggttttagtccctgcaaatatg |
51708725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 52430100 - 52430068
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
52430100 |
ggctaaaatatggttttagtccctgcaaatatg |
52430068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 52441763 - 52441795
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
52441763 |
ggctaaaatatggttttagtccctgcaaatatg |
52441795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 53716921 - 53716953
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
53716921 |
ggctaaaatatggttttagtccctgcaaatatg |
53716953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 43)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 21125719 - 21125753
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
21125719 |
ggctaaaatatagttttagtccctgcaaatatgcc |
21125753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 30337217 - 30337185
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30337217 |
ggctaaaatatagttttagtccctgcaaatatg |
30337185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 4375691 - 4375726
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4375691 |
tggctaaaatatggttttagtccctgcaaatatgcc |
4375726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 4621355 - 4621320
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4621355 |
tggctaaaatatagttttggtccctgcaaatatgcc |
4621320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 10776500 - 10776465
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10776500 |
tggctaaaatatggttttagtccctgcaaatatgcc |
10776465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 16789370 - 16789335
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16789370 |
tggctaaaatatggttttagtccctgcaaatatgcc |
16789335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 28398755 - 28398790
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28398755 |
tggctaaaatatggttttagtccctgcaaatatgcc |
28398790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 40066821 - 40066786
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40066821 |
tggctaaaatatggttttagtccctgcaaatatgcc |
40066786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 259 - 293
Target Start/End: Original strand, 1162908 - 1162942
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
1162908 |
tggctaaaatatggttttagtccctgcaaatatgc |
1162942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 1408353 - 1408319
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1408353 |
ggctaaaatatggttttagtccctgcaaatatgcc |
1408319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 1525809 - 1525843
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1525809 |
ggctaaaatatggttttagtccctgcaaatatgcc |
1525843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 10755528 - 10755494
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10755528 |
ggctaaaatatggttttagtccctgcaaatatgcc |
10755494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 14239080 - 14239046
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14239080 |
ggctaaaatatggttttagtccctgcaaatatgcc |
14239046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 14488716 - 14488750
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14488716 |
ggctaaaatatagttttagtccctgaaaatatgcc |
14488750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 14495069 - 14495103
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14495069 |
ggctaaaatatggttttagtccctgcaaatatgcc |
14495103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 16643661 - 16643695
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16643661 |
ggctaaaatatggttttagtccctgcaaatatgcc |
16643695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 19494413 - 19494379
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19494413 |
ggctaaaatatggttttagtccctgcaaatatgcc |
19494379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 22917564 - 22917598
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22917564 |
ggctaaaatatggttttagtccctgcaaatatgcc |
22917598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 27341591 - 27341557
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27341591 |
ggctaaaatatggttttagtccctgcaaatatgcc |
27341557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 32418318 - 32418352
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32418318 |
ggctaaaatatggttttagtccctgcaaatatgcc |
32418352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 259 - 293
Target Start/End: Original strand, 33526051 - 33526085
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
33526051 |
tggctaaaatatggttttagtccctgcaaatatgc |
33526085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 40066497 - 40066531
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40066497 |
ggctaaaatatggttttagtccctgcaaatatgcc |
40066531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 259 - 293
Target Start/End: Original strand, 40844155 - 40844189
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
40844155 |
tggctaaaatatggttttagtccctgcaaatatgc |
40844189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 43477163 - 43477197
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43477163 |
ggctaaaatatggttttagtccctgcaaatatgcc |
43477197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 294
Target Start/End: Original strand, 4016906 - 4016939
Alignment:
| Q |
261 |
gctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
4016906 |
gctaaaatatggttttagtccctgcaaatatgcc |
4016939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 293
Target Start/End: Complemental strand, 4376010 - 4375977
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
4376010 |
ggctaaaatatggttttagtccctgcaaatatgc |
4375977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 293
Target Start/End: Original strand, 18549201 - 18549234
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
18549201 |
ggctaaaatatggttttagtccctgcaaatatgc |
18549234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 293
Target Start/End: Complemental strand, 29488110 - 29488077
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
29488110 |
ggctaaaatatggttttagtccctgcaaatatgc |
29488077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 293
Target Start/End: Original strand, 33636322 - 33636355
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
33636322 |
ggctaaaatatggttttagtccctgcaaatatgc |
33636355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 1526172 - 1526140
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
1526172 |
ggctaaaatatggttttagtccctgcaaatatg |
1526140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 261 - 293
Target Start/End: Complemental strand, 6146948 - 6146916
Alignment:
| Q |
261 |
gctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
6146948 |
gctaaaatatggttttagtccctgcaaatatgc |
6146916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 7272420 - 7272452
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
7272420 |
ggctaaaatatggttttagtccctgcaaatatg |
7272452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 9908918 - 9908950
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
9908918 |
ggctaaaatatagttttaatccctgcaaatatg |
9908950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 14238751 - 14238783
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
14238751 |
ggctaaaatatggttttagtccctgcaaatatg |
14238783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 291
Target Start/End: Original strand, 15719655 - 15719687
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatat |
291 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
15719655 |
tggctaaaatatggttttagtccctgcaaatat |
15719687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 16644044 - 16644012
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
16644044 |
ggctaaaatatggttttagtccctgcaaatatg |
16644012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 16789075 - 16789107
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
16789075 |
ggctaaaatatggttttagtccctgcaaatatg |
16789107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 19494119 - 19494151
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
19494119 |
ggctaaaatatggttttagtccctgcaaatatg |
19494151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 22650464 - 22650496
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
22650464 |
ggctaaaatatggttttagtccctgcaaatatg |
22650496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 24955010 - 24954978
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
24955010 |
ggctaaaatatggttttagtccctgcaaatatg |
24954978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 25131111 - 25131143
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
25131111 |
ggctaaaatatggttttagtccctgcaaatatg |
25131143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 25600597 - 25600565
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
25600597 |
ggctaaaatatagttttggtccctgcaaatatg |
25600565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 29158354 - 29158386
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
29158354 |
ggctaaaatatggttttagtccctgcaaatatg |
29158386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 30)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 7155797 - 7155831
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
7155797 |
ggctaaaatatagttttagtccctgcaaatatgcc |
7155831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 317812 - 317844
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
317812 |
ggctaaaatatagttttagtccctgcaaatatg |
317844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 494404 - 494439
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
494404 |
tggctaaaatatggttttagtccctgcaaatatgcc |
494439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 15962390 - 15962355
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15962390 |
tggctaaaatatggttttagtccctgcaaatatgcc |
15962355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 19296408 - 19296373
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19296408 |
tggctaaaatatggttttagtccctgcaaatatgcc |
19296373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 34582528 - 34582563
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34582528 |
tggctaaaatatggttttagtccctgcaaatatgcc |
34582563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 1890452 - 1890418
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1890452 |
ggctaaaatatggttttagtccctgcaaatatgcc |
1890418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 2373179 - 2373213
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2373179 |
ggctaaaatatggttttagtccctgcaaatatgcc |
2373213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 2616240 - 2616206
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2616240 |
ggctaaaatatggttttagtccctgcaaatatgcc |
2616206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 7156160 - 7156126
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7156160 |
ggctaaaatatggttttagtccctgcaaatatgcc |
7156126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 8681116 - 8681082
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8681116 |
ggctaaaatatggttttagtccctgcaaatatgcc |
8681082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 15076204 - 15076170
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15076204 |
ggctaaaatatggttttagtccctgcaaatatgcc |
15076170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 15117040 - 15117006
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15117040 |
ggctaaaatatggttttagtccctgcaaatatgcc |
15117006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 259 - 293
Target Start/End: Original strand, 17771910 - 17771944
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
17771910 |
tggctaaaatatggttttagtccctgcaaatatgc |
17771944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 22822651 - 22822617
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22822651 |
ggctaaaatatggttttagtccctgcaaatatgcc |
22822617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 23770439 - 23770405
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23770439 |
ggctaaaatatggttttagtccctgcaaatatgcc |
23770405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 24274131 - 24274097
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24274131 |
ggctaaaatatggttttagtccctgcaaatatgcc |
24274097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 33801743 - 33801709
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33801743 |
ggctaaaatatggttttagtccctgcaaatatgcc |
33801709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 293
Target Start/End: Original strand, 3356142 - 3356175
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
3356142 |
ggctaaaatatggttttagtccctgcaaatatgc |
3356175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 293
Target Start/End: Original strand, 6468310 - 6468343
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
6468310 |
ggctaaaatatggttttagtccctgcaaatatgc |
6468343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 293
Target Start/End: Original strand, 14655379 - 14655412
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
14655379 |
ggctaaaatatggttttagtccctgcaaatatgc |
14655412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 293
Target Start/End: Original strand, 24273828 - 24273861
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
24273828 |
ggctaaaatatggttttagtccctgcaaatatgc |
24273861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 294
Target Start/End: Original strand, 31166871 - 31166904
Alignment:
| Q |
261 |
gctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
31166871 |
gctaaaatatggttttagtccctgcaaatatgcc |
31166904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 292
Target Start/End: Complemental strand, 31167201 - 31167168
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
31167201 |
tggctaaaatatggttttagtccctgcaaatatg |
31167168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 262 - 294
Target Start/End: Complemental strand, 5286949 - 5286917
Alignment:
| Q |
262 |
ctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcc |
5286917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 9896637 - 9896605
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
9896637 |
ggctaaaatatggttttagtccctgcaaatatg |
9896605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 23502540 - 23502508
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
23502540 |
ggctaaaatatggttttagtccctgcaaatatg |
23502508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 24692979 - 24692947
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
24692979 |
ggctaaaatatggttttagtccctgcaaatatg |
24692947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 25431854 - 25431822
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
25431854 |
ggctaaaatatggttttagtccctgcaaatatg |
25431822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 30928681 - 30928713
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
30928681 |
ggctaaaatatggttttagtccctgcaaatatg |
30928713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 39)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 31225715 - 31225749
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
31225715 |
ggctaaaatatagttttagtccctgcaaatatgcc |
31225749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 38731829 - 38731863
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
38731829 |
ggctaaaatatagttttagtccctgcaaatatgcc |
38731863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 3837933 - 3837965
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3837933 |
ggctaaaatatagttttagtccctgcaaatatg |
3837965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 33733242 - 33733207
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33733242 |
tggctaaaatatggttttagtccctgcaaatatgcc |
33733207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 16900206 - 16900172
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16900206 |
ggctaaaatatggttttagtccctgcaaatatgcc |
16900172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 16993597 - 16993563
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16993597 |
ggctaaaatatggttttagtccctgcaaatatgcc |
16993563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 19184151 - 19184117
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19184151 |
ggctaaaatatggttttagtccctgcaaatatgcc |
19184117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 22881613 - 22881647
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22881613 |
ggctaaaatatggttttagtccctgcaaatatgcc |
22881647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 24483891 - 24483857
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24483891 |
ggctaaaatatggttttagtccctgcaaatatgcc |
24483857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 26814229 - 26814195
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26814229 |
ggctaaaatatggttttagtccctgcaaatatgcc |
26814195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 27310876 - 27310910
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27310876 |
ggctaaaatatggttttagtccctgcaaatatgcc |
27310910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 31326252 - 31326218
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
31326252 |
ggctaaaatatagttttagtccttgcaaatatgcc |
31326218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 33732862 - 33732896
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33732862 |
ggctaaaatatggttttagtccctgcaaatatgcc |
33732896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 37271739 - 37271773
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37271739 |
ggctaaaatatggttttagtccctgcaaatatgcc |
37271773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 37272102 - 37272068
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37272102 |
ggctaaaatatggttttagtccctgcaaatatgcc |
37272068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 38980253 - 38980219
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38980253 |
ggctaaaatatggttttagtccctgcaaatatgcc |
38980219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 40301975 - 40302009
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40301975 |
ggctaaaatatggttttagtccctgcaaatatgcc |
40302009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 259 - 293
Target Start/End: Complemental strand, 41791313 - 41791279
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
41791313 |
tggctaaaatatggttttagtccctgcaaatatgc |
41791279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 43788858 - 43788892
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43788858 |
ggctaaaatatggttttagtccctgcaaatatgcc |
43788892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 44073807 - 44073773
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44073807 |
ggctaaaatatggttttagtccctgcaaatatgcc |
44073773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 292
Target Start/End: Complemental strand, 5790900 - 5790867
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
5790900 |
tggctaaaatatggttttagtccctgcaaatatg |
5790867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 292
Target Start/End: Original strand, 9195053 - 9195086
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
9195053 |
tggctaaaatatggttttagtccctgcaaatatg |
9195086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 294
Target Start/End: Original strand, 10374775 - 10374808
Alignment:
| Q |
261 |
gctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
10374775 |
gctaaaatatggttttagtccctgcaaatatgcc |
10374808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 292
Target Start/End: Complemental strand, 10375070 - 10375037
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
10375070 |
tggctaaaatatggttttagtccctgcaaatatg |
10375037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 293
Target Start/End: Complemental strand, 10665294 - 10665261
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
10665294 |
ggctaaaatatagttttagtctctgcaaatatgc |
10665261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 292
Target Start/End: Original strand, 11713484 - 11713517
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
11713484 |
tggctaaaatatggttttagtccctgcaaatatg |
11713517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 292
Target Start/End: Original strand, 26813865 - 26813898
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
26813865 |
tggctaaaatatggttttagtccctgcaaatatg |
26813898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 261 - 293
Target Start/End: Complemental strand, 3838263 - 3838231
Alignment:
| Q |
261 |
gctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
3838263 |
gctaaaatatggttttagtccctgcaaatatgc |
3838231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 10664984 - 10665016
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
10664984 |
ggctaaaatatggttttagtccctgcaaatatg |
10665016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 10671941 - 10671909
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
10671941 |
ggctaaaatatggttttagtccctgcaaatatg |
10671909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 11788416 - 11788384
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
11788416 |
ggctaaaatatggttttagtccctgcaaatatg |
11788384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 19183782 - 19183814
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
19183782 |
ggctaaaatatggttttagtccctgcaaatatg |
19183814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 26239160 - 26239128
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
26239160 |
ggctaaaatatggttttagtccctgcaaatatg |
26239128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 36622250 - 36622282
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
36622250 |
ggctaaaatatggttttagtccctgcaaatatg |
36622282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 38639412 - 38639444
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
38639412 |
ggctaaaatatggttttagtccctgcaaatatg |
38639444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 291
Target Start/End: Original strand, 38979888 - 38979920
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatat |
291 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
38979888 |
tggctaaaatatggttttagtccctgcaaatat |
38979920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 40302339 - 40302307
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
40302339 |
ggctaaaatatggttttagtccctgcaaatatg |
40302307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 41693674 - 41693706
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
41693674 |
ggctaaaatatggttttagtccctgcaaatatg |
41693706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 262 - 294
Target Start/End: Original strand, 44985623 - 44985655
Alignment:
| Q |
262 |
ctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
44985623 |
ctaaaatatggttttagtccctgcaaatatgcc |
44985655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 46)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 261 - 294
Target Start/End: Original strand, 7818783 - 7818816
Alignment:
| Q |
261 |
gctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
7818783 |
gctaaaatatagttttagtccctgcaaatatgcc |
7818816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 7001898 - 7001863
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7001898 |
tggctaaaatatggttttagtccctgcaaatatgcc |
7001863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 24649349 - 24649384
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24649349 |
tggctaaaatatggttttagtccctgcaaatatgcc |
24649384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 29072863 - 29072828
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29072863 |
tggctaaaatatggttttagtccctgcaaatatgcc |
29072828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 35308112 - 35308077
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35308112 |
tggctaaaatatggttttagtccctgcaaatatgcc |
35308077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 48956067 - 48956032
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48956067 |
tggctaaaatatggttttagtccctgcaaatatgcc |
48956032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 52254480 - 52254445
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52254480 |
tggctaaaatatggttttagtccctgcaaatatgcc |
52254445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 990379 - 990345
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
990379 |
ggctaaaatatggttttagtccctgcaaatatgcc |
990345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 1810927 - 1810961
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1810927 |
ggctaaaatatggttttagtccctgcaaatatgcc |
1810961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 11822004 - 11822038
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11822004 |
ggctaaaatatggttttagtccctgcaaatatgcc |
11822038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 13770489 - 13770523
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13770489 |
ggctaaaatatggttttagtccctgcaaatatgcc |
13770523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 18079660 - 18079626
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18079660 |
ggctaaaatatggttttagtccctgcaaatatgcc |
18079626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 18302387 - 18302353
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18302387 |
ggctaaaatatggttttagtccctgcaaatatgcc |
18302353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 18473272 - 18473306
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18473272 |
ggctaaaatatggttttagtccctgcaaatatgcc |
18473306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 18473595 - 18473561
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18473595 |
ggctaaaatatggttttagtccctgcaaatatgcc |
18473561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 22919684 - 22919718
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22919684 |
ggctaaaatatggttttagtccctgcaaatatgcc |
22919718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 26061956 - 26061990
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26061956 |
ggctaaaatatggttttagtccctgcaaatatgcc |
26061990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 259 - 293
Target Start/End: Original strand, 26191358 - 26191392
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
26191358 |
tggctaaaatatggttttagtccctgcaaatatgc |
26191392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 29072497 - 29072531
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29072497 |
ggctaaaatatggttttagtccctgcaaatatgcc |
29072531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 32454294 - 32454260
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32454294 |
ggctaaaatatggttttagtccctgcaaatatgcc |
32454260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 32729049 - 32729015
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32729049 |
ggctaaaatatggttttagtccctgcaaatatgcc |
32729015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 33379888 - 33379922
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33379888 |
ggctaaaatatggttttagtccctgcaaatatgcc |
33379922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 35005444 - 35005478
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35005444 |
ggctaaaatatggttttagtccctgcaaatatgcc |
35005478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 35005744 - 35005710
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35005744 |
ggctaaaatatggttttagtccctgcaaatatgcc |
35005710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 35307715 - 35307749
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35307715 |
ggctaaaatatggttttagtccctgcaaatatgcc |
35307749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 41358369 - 41358403
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41358369 |
ggctaaaatatggttttagtccctgcaaatatgcc |
41358403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 45368490 - 45368524
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45368490 |
ggctaaaatatggttttagtccctgcaaatatgcc |
45368524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 50799130 - 50799164
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
50799130 |
ggctaaaatatggttttagtccctgcaaatatgcc |
50799164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 294
Target Start/End: Original strand, 3753214 - 3753247
Alignment:
| Q |
261 |
gctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
3753214 |
gctaaaatatggttttagtccctgcaaatatgcc |
3753247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 294
Target Start/End: Original strand, 4323829 - 4323862
Alignment:
| Q |
261 |
gctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
4323829 |
gctaaaatatggttttagtccctgcaaatatgcc |
4323862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 292
Target Start/End: Complemental strand, 22953557 - 22953524
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
22953557 |
tggctaaaatatggttttagtccctgcaaatatg |
22953524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 292
Target Start/End: Complemental strand, 26191735 - 26191702
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
26191735 |
tggctaaaatatggttttagtccctgcaaatatg |
26191702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 294
Target Start/End: Original strand, 44641079 - 44641112
Alignment:
| Q |
261 |
gctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
44641079 |
gctaaaatatggttttagtccctgcaaatatgcc |
44641112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 4360626 - 4360594
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
4360626 |
ggctaaaatatggttttagtccctgcaaatatg |
4360594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 6567496 - 6567464
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
6567496 |
ggctaaaatatggttttagtccctgcaaatatg |
6567464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 11822365 - 11822333
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
11822365 |
ggctaaaatatggttttagtccctgcaaatatg |
11822333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 13260321 - 13260289
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
13260321 |
ggctaaaatatggttttagtccctgcaaatatg |
13260289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 14007489 - 14007521
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
14007489 |
ggctaaaatatggttttagtccctgcaaatatg |
14007521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 19622655 - 19622687
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
19622655 |
ggctaaaatatggttttagtccctgcaaatatg |
19622687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 21391096 - 21391128
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
21391096 |
ggctaaaatatggttttagtccctgcaaatatg |
21391128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 26442563 - 26442595
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
26442563 |
ggctaaaatatggttttagtccctgcaaatatg |
26442595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 32626529 - 32626561
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
32626529 |
ggctaaaatatggttttagtccctgcaaatatg |
32626561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 34002940 - 34002908
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
34002940 |
ggctaaaatatggttttagtccctgcaaatatg |
34002908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 41358663 - 41358631
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
41358663 |
ggctaaaatatggttttagtccctgcaaatatg |
41358631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 45290457 - 45290489
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
45290457 |
ggctaaaatatggttttagtccctgcaaatatg |
45290489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 48609594 - 48609562
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
48609594 |
ggctaaaatatggttttagtccctgcaaatatg |
48609562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 54)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 262 - 294
Target Start/End: Complemental strand, 45006247 - 45006215
Alignment:
| Q |
262 |
ctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
45006247 |
ctaaaatatagttttagtccctgcaaatatgcc |
45006215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 8510213 - 8510248
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8510213 |
tggctaaaatatggttttagtccctgcaaatatgcc |
8510248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 10976977 - 10977012
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10976977 |
tggctaaaatatggttttagtccctgcaaatatgcc |
10977012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 15016387 - 15016422
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15016387 |
tggctaaaatatggttttagtccctgcaaatatgcc |
15016422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 25710871 - 25710836
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25710871 |
tggctaaaatatggttttagtccctgcaaatatgcc |
25710836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 3151750 - 3151784
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3151750 |
ggctaaaatatggttttagtccctgcaaatatgcc |
3151784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 3152111 - 3152077
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3152111 |
ggctaaaatatggttttagtccctgcaaatatgcc |
3152077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 3830134 - 3830168
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3830134 |
ggctaaaatatggttttagtccctgcaaatatgcc |
3830168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 3830516 - 3830482
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3830516 |
ggctaaaatatggttttagtccctgcaaatatgcc |
3830482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 4513263 - 4513297
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4513263 |
ggctaaaatatggttttagtccctgcaaatatgcc |
4513297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 4950037 - 4950071
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4950037 |
ggctaaaatatggttttagtccctgcaaatatgcc |
4950071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 7588318 - 7588352
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7588318 |
ggctaaaatatagttttggtccctgcaaatatgcc |
7588352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 12673644 - 12673678
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12673644 |
ggctaaaatatagttttagtccctgtaaatatgcc |
12673678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 13584367 - 13584333
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13584367 |
ggctaaaatatggttttagtccctgcaaatatgcc |
13584333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 20612898 - 20612864
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20612898 |
ggctaaaatatggttttagtccctgcaaatatgcc |
20612864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 21159817 - 21159783
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21159817 |
ggctaaaatatggttttagtccctgcaaatatgcc |
21159783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 28427608 - 28427574
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28427608 |
ggctaaaatatggttttagtccctgcaaatatgcc |
28427574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 28942525 - 28942559
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28942525 |
ggctaaaatatggttttagtccctgcaaatatgcc |
28942559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 37506867 - 37506901
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37506867 |
ggctaaaatatggttttagtccctgcaaatatgcc |
37506901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 37507222 - 37507188
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37507222 |
ggctaaaatatggttttagtccctgcaaatatgcc |
37507188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 39437109 - 39437075
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39437109 |
ggctaaaatatggttttagtccctgcaaatatgcc |
39437075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 259 - 293
Target Start/End: Original strand, 44802281 - 44802315
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
44802281 |
tggctaaaatatggttttagtccctgcaaatatgc |
44802315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 259 - 293
Target Start/End: Complemental strand, 47902146 - 47902112
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
47902146 |
tggctaaaatatagttttagtccccgcaaatatgc |
47902112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 51834608 - 51834642
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51834608 |
ggctaaaatatggttttagtccctgcaaatatgcc |
51834642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 294
Target Start/End: Complemental strand, 3361817 - 3361784
Alignment:
| Q |
261 |
gctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
3361817 |
gctaaaatatggttttagtccctgcaaatatgcc |
3361784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 293
Target Start/End: Complemental strand, 5345689 - 5345656
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
5345689 |
ggctaaaatatggttttagtccctgcaaatatgc |
5345656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 293
Target Start/End: Original strand, 20611020 - 20611053
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
20611020 |
ggctaaaatatggttttagtccctgcaaatatgc |
20611053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 292
Target Start/End: Original strand, 20644504 - 20644537
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
20644504 |
tggctaaaatatagttttggtccctgcaaatatg |
20644537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 294
Target Start/End: Complemental strand, 22156292 - 22156259
Alignment:
| Q |
261 |
gctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
22156292 |
gctaaaatatggttttagtccctgcaaatatgcc |
22156259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 292
Target Start/End: Complemental strand, 40169655 - 40169622
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
40169655 |
tggctaaaatatggttttagtccctgcaaatatg |
40169622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 292
Target Start/End: Complemental strand, 50261937 - 50261904
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
50261937 |
tggctaaaatatcgttttagtccctgcaaatatg |
50261904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 293
Target Start/End: Complemental strand, 51834942 - 51834909
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
51834942 |
ggctaaaatatggttttagtccctgcaaatatgc |
51834909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 4814540 - 4814572
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
4814540 |
ggctaaaatatggttttagtccctgcaaatatg |
4814572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 262 - 294
Target Start/End: Original strand, 14633547 - 14633579
Alignment:
| Q |
262 |
ctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
14633547 |
ctaaaatatggttttagtccctgcaaatatgcc |
14633579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 18175791 - 18175823
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
18175791 |
ggctaaaatatggttttagtccctgcaaatatg |
18175823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 21159453 - 21159485
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
21159453 |
ggctaaaatatggttttagtccctgcaaatatg |
21159485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 22008526 - 22008558
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
22008526 |
ggctaaaatatggttttagtccctgcaaatatg |
22008558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 22016044 - 22016076
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
22016044 |
ggctaaaatatggttttagtccctgcaaatatg |
22016076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 22155929 - 22155961
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
22155929 |
ggctaaaatatggttttagtccctgcaaatatg |
22155961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 26800169 - 26800137
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
26800169 |
ggctaaaatatggttttagtccctgcaaatatg |
26800137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 29446206 - 29446174
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
29446206 |
ggctaaaatatggttttagtccctgcaaatatg |
29446174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 29525105 - 29525137
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
29525105 |
ggctaaaatatggttttagtccctgcaaatatg |
29525137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 262 - 294
Target Start/End: Original strand, 29955300 - 29955332
Alignment:
| Q |
262 |
ctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcc |
29955332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 262 - 294
Target Start/End: Original strand, 30004454 - 30004486
Alignment:
| Q |
262 |
ctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcc |
30004486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 30130158 - 30130190
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
30130158 |
ggctaaaatatggttttagtccctgcaaatatg |
30130190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 30424628 - 30424660
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
30424628 |
ggctaaaatatggttttagtccctgcaaatatg |
30424660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 31869956 - 31869924
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
31869956 |
ggctaaaatatggttttagtccctgcaaatatg |
31869924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 32119220 - 32119252
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
32119220 |
ggctaaaatatagttttggtccctgcaaatatg |
32119252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 34238598 - 34238630
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
34238598 |
ggctaaaatatggttttagtccctgcaaatatg |
34238630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 39288573 - 39288605
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
39288573 |
ggctaaaatatggttttagtccctgcaaatatg |
39288605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 39436718 - 39436750
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
39436718 |
ggctaaaatatggttttagtccctgcaaatatg |
39436750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 262 - 294
Target Start/End: Complemental strand, 43440785 - 43440753
Alignment:
| Q |
262 |
ctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
43440785 |
ctaaaatataattttagtccctgcaaatatgcc |
43440753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 262 - 294
Target Start/End: Original strand, 50196301 - 50196333
Alignment:
| Q |
262 |
ctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcc |
50196333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 53701663 - 53701631
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
53701663 |
ggctaaaatatggttttagtccctgcaaatatg |
53701631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 4313 - 4278
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4313 |
tggctaaaatatggttttagtccctgcaaatatgcc |
4278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 17967 - 17932
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17967 |
tggctaaaatatggttttagtccctgcaaatatgcc |
17932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 2778 - 2812
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2778 |
ggctaaaatatggttttagtccctgcaaatatgcc |
2812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 5209 - 5243
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5209 |
ggctaaaatatggttttagtccctgcaaatatgcc |
5243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 5229 - 5263
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5229 |
ggctaaaatatggttttagtccctgcaaatatgcc |
5263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 9028 - 8994
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9028 |
ggctaaaatatggttttagtccctgcaaatatgcc |
8994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 262 - 294
Target Start/End: Original strand, 8734 - 8766
Alignment:
| Q |
262 |
ctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcc |
8766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 14697 - 14731
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14697 |
ggctaaaatatggttttagtccctgcaaatatgcc |
14731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 15012 - 14980
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
15012 |
ggctaaaatatggttttagtccctgcaaatatg |
14980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 5399 - 5433
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5399 |
ggctaaaatatggttttagtccctgcaaatatgcc |
5433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 5708 - 5676
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
5708 |
ggctaaaatatggttttagtccctgcaaatatg |
5676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 12182 - 12216
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12182 |
ggctaaaatatggttttagtccctgcaaatatgcc |
12216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 10168 - 10202
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10168 |
ggctaaaatatggttttagtccctgcaaatatgcc |
10202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 10515 - 10483
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
10515 |
ggctaaaatatggttttagtccctgcaaatatg |
10483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 366273 - 366239
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgcc |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
366273 |
ggctaaaatatggttttagtccctgcaaatatgcc |
366239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 292
Target Start/End: Complemental strand, 3456 - 3423
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
3456 |
tggctaaaatatagttttagttcctgcaaatatg |
3423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 292
Target Start/End: Original strand, 12524 - 12557
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
12524 |
tggctaaaatatggttttagtccctgcaaatatg |
12557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 292
Target Start/End: Original strand, 3531 - 3564
Alignment:
| Q |
259 |
tggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
3531 |
tggctaaaatatggttttagtccctgcaaatatg |
3564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 293
Target Start/End: Complemental strand, 3918 - 3885
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatgc |
293 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
3918 |
ggctaaaatatggttttagtccctgcaaatatgc |
3885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 1311 - 1343
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
1311 |
ggctaaaatatggttttagtccctgcaaatatg |
1343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 289 - 257
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
289 |
ggctaaaatatggttttagtccctgcaaatatg |
257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 4041 - 4073
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
4041 |
ggctaaaatatggttttagtccctgcaaatatg |
4073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 19223 - 19255
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
19223 |
ggctaaaatatggttttagtccctgcaaatatg |
19255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 8330 - 8362
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
8330 |
ggctaaaatatggttttagtccctgcaaatatg |
8362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 8642 - 8610
Alignment:
| Q |
260 |
ggctaaaatatagttttagtccctgcaaatatg |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
8642 |
ggctaaaatatggttttagtccctgcaaatatg |
8610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University